SZGR2

Summary ?

GeneID	2196
Symbol	FAT2
Synonyms	CDHF8\|CDHR9\|HFAT2\|MEGF1
Description	FAT atypical cadherin 2
Reference	MIM:604269\|HGNC:HGNC:3596\|Ensembl:ENSG00000086570\|HPRD:05041\|Vega:OTTHUMG00000130126
Gene type	protein-coding
Map location	5q33.1
Pascal p-value	0.402
Fetal beta	0.117
eGene	Nucleus accumbens basal ganglia Myers' cis & trans
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.0032
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.01718
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00459

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs17392743	chr1	54764240	FAT2	2196	0.19	trans
rs4661202	chr1	156572983	FAT2	2196	0.14	trans
rs6687849	chr1	175904808	FAT2	2196	0.12	trans
rs2481653	chr1	176044120	FAT2	2196	0.08	trans
rs2502827	chr1	176044216	FAT2	2196	0.01	trans
rs12405921	chr1	206695730	FAT2	2196	0.01	trans
rs17572651	chr1	218943612	FAT2	2196	0.01	trans
rs16829545	chr2	151977407	FAT2	2196	1.667E-19	trans
rs16841750	chr2	158288461	FAT2	2196	0.01	trans
rs3747518	chr2	163128724	FAT2	2196	0.03	trans
rs3845734	chr2	171125572	FAT2	2196	1.247E-5	trans
rs7584986	chr2	184111432	FAT2	2196	1.751E-11	trans
rs16878852	chr4	27115684	FAT2	2196	0.19	trans
rs2183142	chr4	159232695	FAT2	2196	0	trans
rs1396222	chr4	173279496	FAT2	2196	0.13	trans
rs335980	chr4	173329784	FAT2	2196	0.07	trans
rs337984	chr4	173411662	FAT2	2196	0.07	trans
rs6821203	chr4	189475342	FAT2	2196	0.16	trans
rs3111196	chr5	54402889	FAT2	2196	0	trans
rs17762315	chr5	76807576	FAT2	2196	4.387E-6	trans
rs1380396	chr5	100737044	FAT2	2196	0.05	trans
rs6887062	chr5	123850762	FAT2	2196	0.04	trans
rs9461864	chr6	33481468	FAT2	2196	0.04	trans
rs2530313	chr7	148112233	FAT2	2196	0.17	trans
rs4263735	chr8	77931285	FAT2	2196	0.08	trans
rs3118341	chr9	25185518	FAT2	2196	0.04	trans
rs17158735	chr10	2681063	FAT2	2196	0.13	trans
rs2393316	chr10	59333070	FAT2	2196	0.05	trans
rs4980232	chr10	124577756	FAT2	2196	0.09	trans
rs12289208	chr11	125224267	FAT2	2196	0.11	trans
rs1526959	chr12	79753789	FAT2	2196	0.17	trans
rs16955618	chr15	29937543	FAT2	2196	9.358E-33	trans
rs2414599	chr15	58851618	FAT2	2196	0.17	trans
rs154554	chr16	22689068	FAT2	2196	0.09	trans
rs7210845	chr17	54122025	FAT2	2196	0.06	trans
rs11873184	chr18	1584081	FAT2	2196	0.09	trans
rs1041786	chr21	22617710	FAT2	2196	5.045E-5	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-
GO:0005509	calcium ion binding	NAS		-
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	IEA		-
GO:0007156	homophilic cell adhesion	IEA		-
GO:0008150	biological_process	ND		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005575	cellular_component	ND		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE NORMAL DN	33	27	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN	382	224	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
WU APOPTOSIS BY CDKN1A VIA TP53	55	31	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-17-5p/20/93.mr/106/519.d	885	891	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
				hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-221/222	1164	1170	m8	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	1164	1170	m8	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-377	1390	1396	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FAT2