Summary ?
GeneID221662
SymbolRBM24
SynonymsRNPC6|dJ259A10.1
DescriptionRNA binding motif protein 24
ReferenceHGNC:HGNC:21539|Ensembl:ENSG00000112183|HPRD:15228|Vega:OTTHUMG00000014306
Gene typeprotein-coding
Map location6p22.3
Pascal p-value0.461
Fetal beta0.212
DMG1 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IGenome scan meta-analysisPsr: 0.033 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg04876424617280551RBM243.578E-40.4540.042DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs11143640chr976258323RBM242216620.13trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003723RNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016068type I hypersensitivityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
SENGUPTA NASOPHARYNGEAL CARCINOMA DN 349157All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN 5036All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291176All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 6P24 P22 AMPLICON 2117All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 307185All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258160All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430288All SZGR 2.0 genes in this pathway
BRUECKNER TARGETS OF MIRLET7A3 UP 11169All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
KORKOLA EMBRYONIC CARCINOMA VS SEMINOMA DN 2514All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306191All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP 13993All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745475All SZGR 2.0 genes in this pathway
PEDERSEN METASTASIS BY ERBB2 ISOFORM 6 2920All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/107112711341A,m8hsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-124.1108010871A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506107910861A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-125/3513243301Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-142-5p169417001Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-143118011871A,m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-148/15212811287m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-151120712141A,m8hsa-miR-151brainACUAGACUGAAGCUCCUUGAGG
miR-199160016061Ahsa-miR-199aCCCAGUGUUCAGACUACCUGUUC
hsa-miR-199bCCCAGUGUUUAGACUAUCUGUUC
miR-2195505561Ahsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
hsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-221/22212141220m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-26153915461A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-34b336342m8hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-363166416701Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-375547553m8hsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-5396066121Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-9595601m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA