Gene Page: SCUBE3
Summary ?
| GeneID | 222663 |
| Symbol | SCUBE3 |
| Synonyms | CEGF3 |
| Description | signal peptide, CUB domain and EGF like domain containing 3 |
| Reference | MIM:614708|HGNC:HGNC:13655|Ensembl:ENSG00000146197|HPRD:18031|Vega:OTTHUMG00000014562 |
| Gene type | protein-coding |
| Map location | 6p21.3 |
| Pascal p-value | 0.143 |
| Fetal beta | 1.193 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg22777309 | 6 | 35182216 | SCUBE3 | 3.221E-4 | -0.187 | 0.04 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 15234972 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0051260 | protein homooligomerization | IDA | 15234972 | |
| GO:0051291 | protein heterooligomerization | IPI | 15234972 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0009986 | cell surface | IEA | - | |
| GO:0048222 | glycoprotein network | NAS | 15234972 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| NEWMAN ERCC6 TARGETS DN | 39 | 24 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS UP | 169 | 105 | All SZGR 2.0 genes in this pathway |
| NABA SECRETED FACTORS | 344 | 197 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 1085 | 1091 | m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-124/506 | 415 | 421 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-151 | 1198 | 1204 | 1A | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
| miR-182 | 487 | 493 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-25/32/92/363/367 | 1170 | 1176 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
| hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
| hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
| hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
| hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
| miR-9 | 489 | 495 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
| miR-96 | 487 | 493 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.