Gene Page: FGF12
Summary ?
| GeneID | 2257 |
| Symbol | FGF12 |
| Synonyms | FGF12B|FHF1 |
| Description | fibroblast growth factor 12 |
| Reference | MIM:601513|HGNC:HGNC:3668|Ensembl:ENSG00000114279|HPRD:03303|Vega:OTTHUMG00000156132 |
| Gene type | protein-coding |
| Map location | 3q28 |
| Pascal p-value | 0.005 |
| Sherlock p-value | 0.535 |
| eGene | Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PPAP2A | 0.80 | 0.81 |
| ANGPTL6 | 0.80 | 0.84 |
| BDH1 | 0.79 | 0.81 |
| C5orf32 | 0.79 | 0.84 |
| OMG | 0.79 | 0.82 |
| GNPTG | 0.78 | 0.82 |
| ANXA7 | 0.77 | 0.78 |
| SHISA4 | 0.77 | 0.84 |
| HHLA3 | 0.77 | 0.80 |
| ACYP2 | 0.77 | 0.82 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KIAA1949 | -0.67 | -0.60 |
| ZNF300 | -0.65 | -0.56 |
| ZNF551 | -0.65 | -0.58 |
| TUBB2B | -0.65 | -0.62 |
| AC004017.1 | -0.65 | -0.57 |
| FNBP1L | -0.63 | -0.54 |
| SETDB1 | -0.63 | -0.51 |
| MYCN | -0.63 | -0.54 |
| ZNF311 | -0.63 | -0.56 |
| TIGD1 | -0.63 | -0.55 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008083 | growth factor activity | IEA | - | |
| GO:0008083 | growth factor activity | TAS | 8790420 |10049777 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 8790420 |
| GO:0007267 | cell-cell signaling | TAS | 8790420 |10049777 | |
| GO:0007165 | signal transduction | TAS | 8790420 |10049777 | |
| GO:0007507 | heart development | TAS | 10049777 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005615 | extracellular space | TAS | 10049777 | |
| GO:0005634 | nucleus | IDA | 8790420 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
| KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| KEGG MELANOMA | 71 | 57 | All SZGR 2.0 genes in this pathway |
| BORCZUK MALIGNANT MESOTHELIOMA DN | 104 | 59 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| JAZAG TGFB1 SIGNALING VIA SMAD4 UP | 108 | 66 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO BEXAROTENE DN | 29 | 19 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| MORI SMALL PRE BII LYMPHOCYTE UP | 86 | 57 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS DN | 120 | 81 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
| GRADE COLON VS RECTAL CANCER DN | 56 | 36 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| NABA SECRETED FACTORS | 344 | 197 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-384 | 1965 | 1972 | 1A,m8 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
| miR-544 | 1650 | 1656 | m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
| miR-9 | 174 | 180 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.