Summary ?
GeneID22828
SymbolSCAF8
SynonymsRBM16
DescriptionSR-related CTD associated factor 8
ReferenceMIM:616024|HGNC:HGNC:20959|Ensembl:ENSG00000213079|HPRD:11487|Vega:OTTHUMG00000015877
Gene typeprotein-coding
Map location6q25.1-q25.3
Pascal p-value0.034
Fetal beta0.639
DMG1 (# studies)

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg028657176155053990SCAF83.01E-8-0.0179.23E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003723RNA bindingIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855609All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483336All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424268All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN 160101All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP 374247All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422277All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548370All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1073923981Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-1434046m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-1534334391Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-186243249m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-223151157m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
miR-3612152221A,m8hsa-miR-361brainUUAUCAGAAUCUCCAGGGGUAC
miR-3811571641A,m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4484334391Ahsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-493-5p1461521Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU