Summary ?
GeneID22873
SymbolDZIP1
SynonymsDZIP|DZIPt1
DescriptionDAZ interacting zinc finger protein 1
ReferenceMIM:608671|HGNC:HGNC:20908|Ensembl:ENSG00000134874|HPRD:16363|Vega:OTTHUMG00000017224
Gene typeprotein-coding
Map location13q32.1
Pascal p-value5.427E-4
Sherlock p-value0.329

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
NPAT0.900.92
SEC23IP0.900.91
KIAA09470.900.91
C17orf800.890.89
GTF2I0.890.89
GIT20.890.89
FNDC3A0.890.89
NEK40.890.88
RBL20.890.88
MED140.880.88
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
MT-CO2-0.73-0.75
AF347015.21-0.73-0.77
FXYD1-0.72-0.75
IFI27-0.72-0.75
HIGD1B-0.72-0.76
AF347015.31-0.71-0.74
AF347015.8-0.67-0.72
AF347015.33-0.67-0.69
MT-CYB-0.67-0.69
MYL3-0.67-0.72

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15081113 
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007283spermatogenesisIEA-
GO:0007281germ cell developmentNAS15081113 
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIDA15081113 
GO:0005737cytoplasmIDA15081113 
GO:0043234protein complexNAS15081113 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN 460312All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184125All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE UP 8557All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584356All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174695All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514330All SZGR 2.0 genes in this pathway
WANG PROSTATE CANCER ANDROGEN INDEPENDENT 6637All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN 546351All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 473224All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3 160103All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461298All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN 564326All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP 648398All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN 5839All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260174All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS 10868All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457302All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448282All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080713All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN 244157All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/989249301Ahsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU