SZGR2

Summary ?

GeneID	2309
Symbol	FOXO3
Synonyms	AF6q21\|FKHRL1\|FKHRL1P2\|FOXO2\|FOXO3A
Description	forkhead box O3
Reference	MIM:602681\|HGNC:HGNC:3821\|Ensembl:ENSG00000118689\|HPRD:04061\|Vega:OTTHUMG00000015327
Gene type	protein-coding
Map location	6q21
Pascal p-value	3.953E-6
Sherlock p-value	0.258
Fetal beta	0.569
DMG	1 (# studies)
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0078

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg08494708	6	108881870	FOXO3	3.112E-4	-0.175	0.04	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IDA		14734530
GO:0005515	protein binding	IPI		16809346
GO:0016563	transcription activator activity	IDA		10102273
GO:0019901	protein kinase binding	IPI		16751106
GO:0043565	sequence-specific DNA binding	IDA		10102273
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0006915	apoptosis	IDA		10102273
GO:0045648	positive regulation of erythrocyte differentiation	IDA		14734530
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IDA		10102273
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		10102273 \|16751106
GO:0005737	cytoplasm	IDA		10102273 \|16751106

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BCL2L11	BAM \| BIM \| BIM-alpha6 \| BIM-beta6 \| BIM-beta7 \| BOD \| BimEL \| BimL	BCL2-like 11 (apoptosis facilitator)	FoxO3a interacts with the BCL2L11 (Bim) promoter.	BIND	15688014
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	FoxO3 binds the distal region of the p21Cip1 promoter.	BIND	15084259
CDKN1B	CDKN4 \| KIP1 \| MEN1B \| MEN4 \| P27KIP1	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	FOXO3a interacts with p27Kip1 promoter.	BIND	15084260
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	IKK-alpha interacts with and phosphorylates FOXO3a. This interaction was modelled on a demonstrated interaction between IKK-alpha from an unknown species and FOXO3a from human.	BIND	15084260
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	beta-catenin interacts with FOXO3a.	BIND	15905404
FOXG1	BF1 \| BF2 \| FHKL3 \| FKH2 \| FKHL1 \| FKHL2 \| FKHL3 \| FKHL4 \| FOXG1A \| FOXG1B \| FOXG1C \| HBF-1 \| HBF-2 \| HBF-3 \| HBF-G2 \| HBF2 \| HFK1 \| HFK2 \| HFK3 \| KHL2 \| QIN	forkhead box G1	FoxO3 interacts with FoxG1.	BIND	15084259
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	IKK-beta interacts with and phosphorylates FOXO3a.	BIND	15084260
SIRT1	SIR2L1	sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)	FOXO3 interacts with SIRT1.	BIND	14976264
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD	15084259
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	FoxO3 interacts with Smad3.	BIND	15084259
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD,BioGRID	15084259
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	-	HPRD,BioGRID	15084259
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	FoxO3 interacts with Smad4.	BIND	15084259
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Foxo3a interacts with p53.	BIND	15604409
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	-	HPRD,BioGRID	10102273

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER	54	47	All SZGR 2.0 genes in this pathway
BIOCARTA AKT PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA PTEN PATHWAY	18	14	All SZGR 2.0 genes in this pathway
BIOCARTA ACH PATHWAY	16	13	All SZGR 2.0 genes in this pathway
BIOCARTA LONGEVITY PATHWAY	15	13	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN B LYMPHOCYTES	36	31	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID HDAC CLASSIII PATHWAY	25	20	All SZGR 2.0 genes in this pathway
PID FOXO PATHWAY	49	43	All SZGR 2.0 genes in this pathway
PID PI3KCI PATHWAY	49	40	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID PI3KCI AKT PATHWAY	35	30	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID PI3K PLC TRK PATHWAY	36	31	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF	217	167	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY SCF KIT	78	59	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NODAL	18	11	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB2	101	78	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY EGFR IN CANCER	109	80	All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB4 SIGNALING	38	28	All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB2 SIGNALING	44	34	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR	97	66	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR	126	90	All SZGR 2.0 genes in this pathway
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE	137	105	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR IN DISEASE	127	88	All SZGR 2.0 genes in this pathway
REACTOME PI3K AKT ACTIVATION	38	29	All SZGR 2.0 genes in this pathway
REACTOME GAB1 SIGNALOSOME	38	29	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY PDGF	122	93	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION	95	76	All SZGR 2.0 genes in this pathway
REACTOME PI 3K CASCADE	56	39	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR	100	74	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
REACTOME PIP3 ACTIVATES AKT SIGNALING	29	20	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR	112	80	All SZGR 2.0 genes in this pathway
ZERBINI RESPONSE TO SULINDAC UP	9	6	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP	177	113	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK TARGETS	18	15	All SZGR 2.0 genes in this pathway
SCHEIDEREIT IKK INTERACTING PROTEINS	58	45	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
AMUNDSON RESPONSE TO ARSENITE	217	143	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP	176	111	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP	227	137	All SZGR 2.0 genes in this pathway
WANG HCP PROSTATE CANCER	111	69	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A DN	110	78	All SZGR 2.0 genes in this pathway
HE PTEN TARGETS DN	7	6	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT UP	197	110	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO UP	205	126	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART UP	103	69	All SZGR 2.0 genes in this pathway
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN DN	51	32	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS STIMULATED DN	11	9	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING DN	36	24	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
GU PDEF TARGETS DN	39	20	All SZGR 2.0 genes in this pathway
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN	102	65	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP	293	203	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE DN	204	114	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1	68	50	All SZGR 2.0 genes in this pathway
QI HYPOXIA	140	96	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN	115	73	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-122	4314	4321	1A,m8	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-128	3257	3263	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	3257	3263	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-132/212	162	169	1A,m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	162	169	1A,m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-153	223	229	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	914	921	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-182	914	921	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-205	4459	4465	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-223	42	49	1A,m8	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-27	3257	3264	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	3257	3264	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-29	1312	1318	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-5p	109	115	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-448	223	229	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-493-5p	1533	1539	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-495	389	395	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-495	389	395	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	4949	4956	1A,m8	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-542-3p	1789	1795	1A	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA
miR-9	3175	3181	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	915	921	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC
miR-96	915	921	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FOXO3