Summary ?
GeneID23235
SymbolSIK2
SynonymsLOH11CR1I|QIK|SIK-2|SNF1LK2
Descriptionsalt inducible kinase 2
ReferenceMIM:608973|HGNC:HGNC:21680|HPRD:12348|
Gene typeprotein-coding
Map location11q23.1
Pascal p-value0.982
DMG1 (# studies)
SupportAscano FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg2141942811111473938SIK21.14E-8-0.0114.8E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
TCTEX1D20.800.87
NDUFS40.800.83
NDUFAF20.800.82
TXN0.780.75
GTF2A20.780.82
ATP5E0.780.74
CHCHD10.780.81
TXNDC170.770.79
ARL160.770.77
SNRPD20.770.77
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.15-0.56-0.66
AF347015.26-0.55-0.67
EPAS1-0.55-0.68
MMRN2-0.54-0.57
AF347015.2-0.54-0.64
AF347015.8-0.53-0.62
MT-CYB-0.53-0.62
TGM2-0.53-0.62
PRELP-0.53-0.65
HLA-E-0.53-0.65

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0000287magnesium ion bindingIDA14976552 
GO:0005515protein bindingIEA-
GO:0005524ATP bindingIDA14976552 
GO:0004674protein serine/threonine kinase activityIDA14976552 
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIDA14976552 
GO:0007243protein kinase cascadeIDA14976552 
GO:0046626regulation of insulin receptor signaling pathwayISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmISS-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID LKB1 PATHWAY 4737All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391222All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN 275168All SZGR 2.0 genes in this pathway
KANG GIST WITH PDGFRA UP 5027All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS 183115All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G 17196All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658397All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-101268626921Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-103/107153215391A,m8hsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-124/50610381044m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-137121112171Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-142-3p26822688m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
miR-144268626921Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-1451261331A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-218150815151A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-329267626821Ahsa-miR-329brainAACACACCUGGUUAACCUCUUU