Summary ?
GeneID23245
SymbolASTN2
SynonymsbA67K19.1
Descriptionastrotactin 2
ReferenceMIM:612856|HGNC:HGNC:17021|Ensembl:ENSG00000148219|HPRD:12498|Vega:OTTHUMG00000021013
Gene typeprotein-coding
Map location9q33.1
Pascal p-value0.401
Sherlock p-value0.002
Fetal beta0.96
eGeneCerebellar Hemisphere
Cerebellum
SupportG2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
ONKEN UVEAL MELANOMA UP 783507All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391222All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP 332228All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380215All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269146All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP 12171All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q 11671All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION DN 4831All SZGR 2.0 genes in this pathway
THEODOROU MAMMARY TUMORIGENESIS 3124All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 16521023All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR DN 4831All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940425All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN 8558All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701446All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP 221120All SZGR 2.0 genes in this pathway
KUMAR PATHOGEN LOAD BY MACROPHAGES 275155All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP 16697All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1553383441Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG