SZGR2

Summary ?

GeneID	23348
Symbol	DOCK9
Synonyms	ZIZ1\|ZIZIMIN1
Description	dedicator of cytokinesis 9
Reference	MIM:607325\|HGNC:HGNC:14132\|Ensembl:ENSG00000088387\|HPRD:09542\|Vega:OTTHUMG00000017260
Gene type	protein-coding
Map location	13q32.3
Pascal p-value	0.915
Sherlock p-value	0.112
DMG	2 (# studies)
eGene	Anterior cingulate cortex BA24 Myers' cis & trans
Support	CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg21712331	13	99630489	DOCK9	4.84E-4	-0.722	0.046	DMG:Wockner_2014
cg10811485	13	99630583	DOCK9	4.921E-4	-0.673	0.047	DMG:Wockner_2014
cg04836038	13	99739382	DOCK9		-0.041	0.75	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16894557	chr6	28999825	DOCK9	23348		0.06		trans
rs3825428	13	99398883	DOCK9	ENSG00000088387.13	1.45694E-6	0.04	339996	gtex_brain_ba24
rs3782997	13	99398932	DOCK9	ENSG00000088387.13	1.45694E-6	0.04	339947	gtex_brain_ba24
rs3782994	13	99401848	DOCK9	ENSG00000088387.13	1.45694E-6	0.04	337031	gtex_brain_ba24

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C11orf82	0.87	0.83
KNTC1	0.87	0.81
PCNA	0.86	0.76
FANCD2	0.86	0.82
C21orf45	0.86	0.81
PLK4	0.85	0.83
NCAPG2	0.85	0.82
GINS2	0.85	0.60
TIMELESS	0.85	0.74
STIL	0.84	0.81

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.27	-0.63	-0.79
AF347015.33	-0.62	-0.78
MT-CO2	-0.62	-0.79
AF347015.31	-0.62	-0.77
MT-CYB	-0.61	-0.78
AF347015.8	-0.61	-0.80
AF347015.15	-0.61	-0.79
HLA-F	-0.59	-0.69
AIFM3	-0.59	-0.69
AF347015.2	-0.59	-0.77

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005085	guanyl-nucleotide exchange factor activity	IEA		-
GO:0005525	GTP binding	IEA		-
GO:0051020	GTPase binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008150	biological_process	ND		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0012505	endomembrane system	IEA		-
GO:0005575	cellular_component	ND		-
GO:0016020	membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID CDC42 REG PATHWAY	30	22	All SZGR 2.0 genes in this pathway
REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION	132	101	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR DN	167	100	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 XPCS DN	88	71	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD DN	84	63	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
GOLDRATH IMMUNE MEMORY	65	42	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 10	30	17	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM	302	191	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS UP	175	116	All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART UP	103	69	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP	317	208	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL DN	216	143	All SZGR 2.0 genes in this pathway
KESHELAVA MULTIPLE DRUG RESISTANCE	88	56	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA MF DN	41	28	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-136	977	983	1A	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-148/152	472	479	1A,m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	929	935	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	1039	1046	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-203.1	854	860	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-208	347	353	1A	hsa-miR-208	AUAAGACGAGCAAAAAGCUUGU
miR-214	1204	1210	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-25/32/92/363/367	970	977	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-409-3p	554	560	1A	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-410	1118	1124	m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-448	928	935	1A,m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-452	164	170	m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-455	551	557	m8	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-455	551	557	m8	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-493-5p	803	809	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-499	347	353	1A	hsa-miR-499	UUAAGACUUGCAGUGAUGUUUAA
miR-9	739	745	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	1040	1046	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DOCK9