Summary ?
GeneID23420
SymbolNOMO1
SynonymsNomo|PM5
DescriptionNODAL modulator 1
ReferenceMIM:609157|HGNC:HGNC:30060|Ensembl:ENSG00000103512|HPRD:11398|Vega:OTTHUMG00000090541
Gene typeprotein-coding
Map location16p13.11
Pascal p-value0.003
SupportCompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
GO:0005515protein bindingIPI15231747 
GO:0030246carbohydrate bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
WANG ESOPHAGUS CANCER VS NORMAL UP 12172All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP 176111All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP 380213All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE UP 283177All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA 176122All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN 287208All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN 270181All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN 228114All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871505All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN 210128All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway
HUANG GATA2 TARGETS DN 7252All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2142212271Ahsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-25/32/92/363/367189195m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-542-3p213219m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA