Summary ?
GeneID23551
SymbolRASD2
SynonymsMGC:4834|Rhes|TEM2
DescriptionRASD family member 2
ReferenceMIM:612842|HGNC:HGNC:18229|Ensembl:ENSG00000100302|HPRD:15210|Vega:OTTHUMG00000150607
Gene typeprotein-coding
Map location22q13.1
Pascal p-value0.809
Sherlock p-value0.923
Fetal beta-1.557

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophreniasClick to show details
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0071 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityNAS11976265 
GO:0005525GTP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007626locomotory behaviorIEA-
GO:0007264small GTPase mediated signal transductionIC11976265 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0005622intracellularIEA-
GO:0005737cytoplasmIDA18029348 
GO:0005886plasma membraneIDA18029348 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
ACEVEDO METHYLATED IN LIVER CANCER DN 940425All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549316All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745475All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364236All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1017427491A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-1447437491Ahsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-495195619631A,m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-913561362m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA