SZGR2

Summary ?

GeneID	23621
Symbol	BACE1
Synonyms	ASP2\|BACE\|HSPC104
Description	beta-site APP-cleaving enzyme 1
Reference	MIM:604252\|HGNC:HGNC:933\|Ensembl:ENSG00000186318\|HPRD:07255\|Vega:OTTHUMG00000160636
Gene type	protein-coding
Map location	11q23.2-q23.3
Pascal p-value	0.927
Sherlock p-value	0.917
Fetal beta	-0.274
eGene	Cerebellar Hemisphere Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.006
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs6829546	chr4	12587664	BACE1	23621		0.14		trans
rs6448932	chr4	12595798	BACE1	23621		0.17		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004190	aspartic-type endopeptidase activity	IDA		10531052
GO:0004190	aspartic-type endopeptidase activity	IEA		-
GO:0008798	beta-aspartyl-peptidase activity	TAS		10591214
GO:0008233	peptidase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006508	proteolysis	IDA		10531052
GO:0006508	proteolysis	IEA		-
GO:0006509	membrane protein ectodomain proteolysis	TAS		12354787
GO:0050435	beta-amyloid metabolic process	IDA		15080893
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030424	axon	IEA	neuron, axon, Neurotransmitter (GO term level: 6)	-
GO:0005794	Golgi apparatus	IDA		10531052
GO:0005768	endosome	IDA		10531052
GO:0016020	membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		10887202
GO:0031410	cytoplasmic vesicle	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ALZHEIMERS DISEASE	169	110	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP	285	181	All SZGR 2.0 genes in this pathway
RODRIGUES DCC TARGETS DN	121	84	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2A DN	141	84	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
TANG SENESCENCE TP53 TARGETS UP	33	20	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
OUILLETTE CLL 13Q14 DELETION DN	60	38	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR DN	191	123	All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP	871	505	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A UP	111	70	All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2	356	214	All SZGR 2.0 genes in this pathway
GYORFFY DOXORUBICIN RESISTANCE	56	34	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	3526	3533	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	3526	3532	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	3526	3532	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-135	1722	1729	1A,m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	1722	1729	1A,m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-141/200a	1551	1558	1A,m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	1551	1558	1A,m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-15/16/195/424/497	267	273	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-19	3448	3455	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	3448	3455	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-214	431	437	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-24*	2904	2910	1A	hsa-miR-189	GUGCCUACUGAGCUGAUAUCAGU
miR-29	1052	1058	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-299-5p	1728	1734	1A	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-30-3p	2188	2194	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	2188	2194	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-369-3p	2156	2163	1A,m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	2157	2163	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-378*	2819	2825	m8	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	2819	2825	m8	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-7	992	998	m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-9	2732	2739	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BACE1