Gene Page: BACE1
Summary ?
GeneID | 23621 |
Symbol | BACE1 |
Synonyms | ASP2|BACE|HSPC104 |
Description | beta-site APP-cleaving enzyme 1 |
Reference | MIM:604252|HGNC:HGNC:933|Ensembl:ENSG00000186318|HPRD:07255|Vega:OTTHUMG00000160636 |
Gene type | protein-coding |
Map location | 11q23.2-q23.3 |
Pascal p-value | 0.927 |
Sherlock p-value | 0.917 |
Fetal beta | -0.274 |
eGene | Cerebellar Hemisphere Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6829546 | chr4 | 12587664 | BACE1 | 23621 | 0.14 | trans | ||
rs6448932 | chr4 | 12595798 | BACE1 | 23621 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004190 | aspartic-type endopeptidase activity | IDA | 10531052 | |
GO:0004190 | aspartic-type endopeptidase activity | IEA | - | |
GO:0008798 | beta-aspartyl-peptidase activity | TAS | 10591214 | |
GO:0008233 | peptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | IDA | 10531052 | |
GO:0006508 | proteolysis | IEA | - | |
GO:0006509 | membrane protein ectodomain proteolysis | TAS | 12354787 | |
GO:0050435 | beta-amyloid metabolic process | IDA | 15080893 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0005794 | Golgi apparatus | IDA | 10531052 | |
GO:0005768 | endosome | IDA | 10531052 | |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 10887202 | |
GO:0031410 | cytoplasmic vesicle | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
RODRIGUES DCC TARGETS DN | 121 | 84 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A DN | 141 | 84 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
TANG SENESCENCE TP53 TARGETS UP | 33 | 20 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
ROZANOV MMP14 TARGETS UP | 266 | 171 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
OUILLETTE CLL 13Q14 DELETION DN | 60 | 38 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
LABBE TARGETS OF TGFB1 AND WNT3A UP | 111 | 70 | All SZGR 2.0 genes in this pathway |
COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
GYORFFY DOXORUBICIN RESISTANCE | 56 | 34 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 3526 | 3533 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 3526 | 3532 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-135 | 1722 | 1729 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-141/200a | 1551 | 1558 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-15/16/195/424/497 | 267 | 273 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-19 | 3448 | 3455 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-214 | 431 | 437 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
miR-24* | 2904 | 2910 | 1A | hsa-miR-189 | GUGCCUACUGAGCUGAUAUCAGU |
miR-29 | 1052 | 1058 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-299-5p | 1728 | 1734 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-30-3p | 2188 | 2194 | 1A | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-369-3p | 2156 | 2163 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 2157 | 2163 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-378* | 2819 | 2825 | m8 | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
miR-7 | 992 | 998 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
miR-9 | 2732 | 2739 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.