SZGR2

Summary ?

GeneID	23670
Symbol	TMEM2
Synonyms	-
Description	transmembrane protein 2
Reference	MIM:605835\|HGNC:HGNC:11869\|Ensembl:ENSG00000135048\|HPRD:09317\|Vega:OTTHUMG00000020000
Gene type	protein-coding
Map location	9q21.13
Pascal p-value	0.854
Sherlock p-value	0.461
Fetal beta	0.165
DMG	1 (# studies)
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
Expression	Meta-analysis of gene expression	P value: 1.939

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg03358216	9	74383998	TMEM2	1.49E-8	-0.025	5.69E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	TAS		10767548

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PROVENZANI METASTASIS UP	194	112	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP	214	144	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK UP	271	175	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP	169	127	All SZGR 2.0 genes in this pathway
LI CISPLATIN RESISTANCE UP	28	20	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
PETRETTO HEART MASS QTL CIS DN	24	15	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D DN	64	35	All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN	354	216	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
SEKI INFLAMMATORY RESPONSE LPS UP	77	56	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G6 UP	65	43	All SZGR 2.0 genes in this pathway
NIELSEN GIST	98	66	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF	222	159	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1470	1477	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-132/212	77	83	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	77	83	1A	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-224	1658	1664	1A	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-23	35	42	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	35	42	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-26	383	390	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	383	390	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-320	724	731	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-323	35	41	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TMEM2