Gene Page: SDF2L1
Summary ?
| GeneID | 23753 |
| Symbol | SDF2L1 |
| Synonyms | - |
| Description | stromal cell derived factor 2 like 1 |
| Reference | MIM:607551|HGNC:HGNC:10676|Ensembl:ENSG00000128228|HPRD:09614|Vega:OTTHUMG00000150820 |
| Gene type | protein-coding |
| Map location | 22q11.21 |
| Pascal p-value | 0.005 |
| Sherlock p-value | 0.591 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs1846326 | chr15 | 28063877 | SDF2L1 | 23753 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016810 | hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005783 | endoplasmic reticulum | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| UDAYAKUMAR MED1 TARGETS UP | 135 | 82 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA BY DMOG DN | 59 | 40 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA UP | 16 | 7 | All SZGR 2.0 genes in this pathway |
| PACHER TARGETS OF IGF1 AND IGF2 UP | 35 | 27 | All SZGR 2.0 genes in this pathway |
| WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS INTERMEDIATE PROGENITOR | 149 | 84 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP | 180 | 114 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR DN | 277 | 166 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G2 | 27 | 17 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 92 | 98 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-543 | 109 | 115 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.