Summary ?
GeneID23761
SymbolPISD
SynonymsDJ858B16|PSD|PSDC|PSSC|dJ858B16.2
Descriptionphosphatidylserine decarboxylase
ReferenceMIM:612770|HGNC:HGNC:8999|Ensembl:ENSG00000241878|HPRD:17854|Vega:OTTHUMG00000030252
Gene typeprotein-coding
Map location22q12.2
Pascal p-value0.205
Fetal beta-0.358
eGeneCerebellum
Frontal Cortex BA9
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGCnpGenome-wide Association StudyGWAS
DNM:Ambalavanan_2016Whole Exome SequencingThis dataset includes 20 de novo mutations detected in 17 COS probands.
GSMA_IGenome scan meta-analysisPsr: 0.031 

Section I. Genetics and epigenetics annotation

@DNM table

GeneChromosomePositionRefAltTranscriptAA changeMutation typeSiftCG46TraitStudy
PISDchr2232021757CTNM_014338p.(=)synonymous SNVChildhood-onset schizophreniaDNM:Ambalavanan_2016

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs17572651chr1218943612PISD237610.13trans
rs16829545chr2151977407PISD237615.006E-9trans
rs3845734chr2171125572PISD237610.06trans
rs7584986chr2184111432PISD237610.01trans
rs17762315chr576807576PISD237610.03trans
rs2393316chr1059333070PISD237610.03trans
rs11185824chr1091393711PISD237610.13trans
rs16955618chr1529937543PISD237611.112E-13trans
rs1041786chr2122617710PISD237610.03trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004609phosphatidylserine decarboxylase activityIEA-
GO:0016829lyase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008654phospholipid biosynthetic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005739mitochondrionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG GLYCEROPHOSPHOLIPID METABOLISM 7735All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY 4429All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA UP 183119All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382904All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184125All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372227All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278748All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP 552347All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION UP 12678All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE UP 9062All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN 8666All SZGR 2.0 genes in this pathway
JAZAERI BREAST CANCER BRCA1 VS BRCA2 UP 4928All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911527All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011592All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528324All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN 238145All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP 756494All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP 682440All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548370All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824528All SZGR 2.0 genes in this pathway
HOLLEMAN VINCRISTINE RESISTANCE B ALL UP 3822All SZGR 2.0 genes in this pathway
HOLLEMAN VINCRISTINE RESISTANCE ALL UP 2716All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/4978198261A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-485-3p104210491A,m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-5038208261Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG