SZGR2

Summary ?

GeneID	24149
Symbol	ZNF318
Synonyms	HRIHFB2436\|TZF\|ZFP318
Description	zinc finger protein 318
Reference	HGNC:HGNC:13578\|Ensembl:ENSG00000171467\|HPRD:11707\|Vega:OTTHUMG00000014732
Gene type	protein-coding
Map location	6p21.1
Pascal p-value	1.125E-6
Sherlock p-value	0.287
Fetal beta	0.447
DMG	2 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04433

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg11037064	6	43336719	ZNF318	4.73E-5	-0.412	0.021	DMG:Wockner_2014
cg11928635	6	43337708	ZNF318		-0.031	0.29	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs12477018	chr2	10519846	ZNF318	24149	0.17	trans
rs6954503	chr7	45155967	ZNF318	24149	0.17	trans
rs3803498	chr15	63053678	ZNF318	24149	0.03	trans
rs3803497	chr15	63053857	ZNF318	24149	0.05	trans
rs3825972	chr15	63054068	ZNF318	24149	0.02	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003676	nucleic acid binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0007126	meiosis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP	137	94	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP	165	106	All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN	180	101	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP	176	115	All SZGR 2.0 genes in this pathway
MA PITUITARY FETAL VS ADULT DN	19	17	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE B ALL DN	15	10	All SZGR 2.0 genes in this pathway
HOLLEMAN PREDNISOLONE RESISTANCE ALL UP	19	15	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE ALL DN	25	14	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN	114	69	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	937	943	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-323	1051	1057	m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-330	339	345	1A	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-488	87	93	1A	hsa-miR-488	CCCAGAUAAUGGCACUCUCAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ZNF318