Gene Page: FUS
Summary ?
GeneID | 2521 |
Symbol | FUS |
Synonyms | ALS6|ETM4|FUS1|HNRNPP2|POMP75|TLS |
Description | FUS RNA binding protein |
Reference | MIM:137070|HGNC:HGNC:4010|Ensembl:ENSG00000089280|HPRD:00660|Vega:OTTHUMG00000132395 |
Gene type | protein-coding |
Map location | 16p11.2 |
Pascal p-value | 0.226 |
Sherlock p-value | 0.178 |
Fetal beta | 0.817 |
DMG | 1 (# studies) |
Support | G2Cdb.humanNRC G2Cdb.humanPSP Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg17022635 | 16 | 31190875 | FUS | 1.09E-8 | -0.008 | 4.61E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ISG15 | 0.98 | 0.89 |
OAS1 | 0.94 | 0.84 |
BST2 | 0.93 | 0.82 |
IFITM1 | 0.92 | 0.80 |
IFI35 | 0.89 | 0.84 |
OASL | 0.88 | 0.81 |
PLA1A | 0.85 | 0.70 |
TAP1 | 0.84 | 0.79 |
PSMB8 | 0.84 | 0.84 |
HLA-A | 0.82 | 0.65 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
DDX42 | -0.46 | -0.63 |
GGNBP2 | -0.45 | -0.61 |
C14orf102 | -0.45 | -0.62 |
ABCF1 | -0.45 | -0.60 |
USP48 | -0.45 | -0.66 |
IWS1 | -0.45 | -0.73 |
PELP1 | -0.45 | -0.68 |
ANKRD17 | -0.44 | -0.66 |
RNASEN | -0.44 | -0.74 |
SF3B2 | -0.44 | -0.68 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | - | |
GO:0003677 | DNA binding | IEA | - | |
GO:0003723 | RNA binding | TAS | 8510758 | |
GO:0005515 | protein binding | IPI | 9774382 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000398 | nuclear mRNA splicing, via spliceosome | EXP | 12226669 | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | TAS | 8510758 | |
GO:0005730 | nucleolus | IDA | 18029348 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
EIF6 | 2 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBP | eukaryotic translation initiation factor 6 | Affinity Capture-MS | BioGRID | 17353931 |
FUSIP1 | FUSIP2 | NSSR | SFRS13 | SRp38 | SRrp40 | TASR | TASR1 | TASR2 | FUS interacting protein (serine/arginine-rich) 1 | - | HPRD,BioGRID | 9774382|10779324 |
GRIN1 | NMDA1 | NMDAR1 | NR1 | glutamate receptor, ionotropic, N-methyl D-aspartate 1 | - | HPRD | 10862698 |
ILF3 | CBTF | DRBF | DRBP76 | MMP4 | MPHOSPH4 | MPP4 | NF-AT-90 | NF110 | NF90 | NFAR | NFAR-1 | NFAR2 | TCP110 | TCP80 | interleukin enhancer binding factor 3, 90kDa | - | HPRD,BioGRID | 11438536 |
PRMT1 | ANM1 | HCP1 | HRMT1L2 | IR1B4 | protein arginine methyltransferase 1 | - | HPRD,BioGRID | 11850402 |
PTBP1 | HNRNP-I | HNRNPI | HNRPI | MGC10830 | MGC8461 | PTB | PTB-1 | PTB-T | PTB2 | PTB3 | PTB4 | pPTB | polypyrimidine tract binding protein 1 | - | HPRD | 12581738 |
PTBP2 | FLJ34897 | PTB | PTBLP | brPTB | nPTB | nPTB5 | nPTB6 | nPTB7 | nPTB8 | polypyrimidine tract binding protein 2 | Affinity Capture-Western | BioGRID | 12581738 |
RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | - | HPRD,BioGRID | 11278855 |
RXRA | FLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1 | retinoid X receptor, alpha | - | HPRD,BioGRID | 9440806 |
SF1 | D11S636 | ZFM1 | ZNF162 | splicing factor 1 | - | HPRD,BioGRID | 9660765 |
SFRS2 | PR264 | SC-35 | SC35 | SFRS2A | SRp30b | splicing factor, arginine/serine-rich 2 | - | HPRD | 9774382 |
SPI1 | OF | PU.1 | SFPI1 | SPI-1 | SPI-A | spleen focus forming virus (SFFV) proviral integration oncogene spi1 | - | HPRD,BioGRID | 9478924 |
SRRM1 | 160-KD | MGC39488 | POP101 | SRM160 | serine/arginine repetitive matrix 1 | - | HPRD,BioGRID | 12581738 |
THRA | AR7 | EAR7 | ERB-T-1 | ERBA | ERBA1 | MGC000261 | MGC43240 | NR1A1 | THRA1 | THRA2 | c-ERBA-1 | thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) | - | HPRD,BioGRID | 9440806 |
USF2 | FIP | bHLHb12 | upstream transcription factor 2, c-fos interacting | Affinity Capture-MS | BioGRID | 17353931 |
YBX1 | BP-8 | CSDA2 | CSDB | DBPB | MDR-NF1 | MGC104858 | MGC110976 | MGC117250 | NSEP-1 | NSEP1 | YB-1 | YB1 | Y box binding protein 1 | - | HPRD,BioGRID | 12168660 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA | 140 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA PROCESSING | 161 | 86 | All SZGR 2.0 genes in this pathway |
REACTOME MRNA SPLICING | 111 | 58 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
HOOI ST7 TARGETS DN | 123 | 78 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS DN | 139 | 76 | All SZGR 2.0 genes in this pathway |
ODONNELL TARGETS OF MYC AND TFRC DN | 45 | 25 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK DN | 137 | 97 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
ALCALA APOPTOSIS | 88 | 60 | All SZGR 2.0 genes in this pathway |
FALVELLA SMOKERS WITH LUNG CANCER | 80 | 52 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS DN | 234 | 137 | All SZGR 2.0 genes in this pathway |
MARIADASON RESPONSE TO CURCUMIN SULINDAC 5 | 23 | 17 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOCYTE | 72 | 55 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D UP | 139 | 95 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
LIU VAV3 PROSTATE CARCINOGENESIS UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
FONTAINE PAPILLARY THYROID CARCINOMA UP | 66 | 38 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
KYNG RESPONSE TO H2O2 VIA ERCC6 DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 1 DN | 63 | 39 | All SZGR 2.0 genes in this pathway |
KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
GUO TARGETS OF IRS1 AND IRS2 | 98 | 67 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-141/200a | 46 | 53 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.