Summary ?
GeneID2596
SymbolGAP43
SynonymsB-50|PP46
Descriptiongrowth associated protein 43
ReferenceMIM:162060|HGNC:HGNC:4140|Ensembl:ENSG00000172020|HPRD:01198|Vega:OTTHUMG00000133758
Gene typeprotein-coding
Map location3q13.31
Pascal p-value0.18
Sherlock p-value0.885
Fetal beta-0.389
DMG1 (# studies)
eGeneCortex
SupportCANABINOID
DOPAMINE
METABOTROPIC GLUTAMATE RECEPTOR
SEROTONIN
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.human_clathrin
G2Cdb.human_PocklingtonH1
G2Cdb.human_Synaptosome
G2Cdb.humanNRC
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Nishioka_2013Genome-wide DNA methylation analysisThe authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 1
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.04047 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 5 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0265 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg002163613115342527GAP43-0.0240.63DMG:Nishioka_2013


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005516calmodulin bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016198axon choice point recognitionIEAneuron, axon (GO term level: 14)-
GO:0010001glial cell differentiationIEAGlial (GO term level: 8)-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0001558regulation of cell growthIEA-
GO:0007205activation of protein kinase C activityTAS3272162 
GO:0009611response to woundingTAS3272162 
GO:0007275multicellular organismal developmentIEA-
GO:0040008regulation of growthIEA-
GO:0045165cell fate commitmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0042995cell projectionIEAaxon (GO term level: 4)-
GO:0030424axonIEAneuron, axon, Neurotransmitter (GO term level: 6)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID NCADHERIN PATHWAY 3332All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536332All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 14699All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP 238135All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN 5745All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290172All SZGR 2.0 genes in this pathway
POMEROY MEDULLOBLASTOMA PROGNOSIS UP 4730All SZGR 2.0 genes in this pathway
NADLER HYPERGLYCEMIA AT OBESITY 5835All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION DN 3023All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237837All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178111All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C3 3624All SZGR 2.0 genes in this pathway
LEIN NEURON MARKERS 6945All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER WITH H3K27ME3 19693All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE UP 12692All SZGR 2.0 genes in this pathway
NUTT GBM VS AO GLIOMA UP 4634All SZGR 2.0 genes in this pathway
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE UP 3624All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718401All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445257All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 5 3022All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP 13993All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137655All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN 315215All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP 570339All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS UP 163111All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517302All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-130/301288294m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152289295m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-1855157m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-191385391m8hsa-miR-191brainCAACGGAAUCCCAAAAGCAGCU
miR-25/32/92/363/367377383m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-3701821881Ahsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-378*4014071Ahsa-miR-422bCUGGACUUGGAGUCAGAAGGCC
hsa-miR-422aCUGGACUUAGGGUCAGAAGGCC
miR-4521561621Ahsa-miR-452UGUUUGCAGAGGAAACUGAGAC