Summary ?
GeneID26119
SymbolLDLRAP1
SynonymsARH|ARH1|ARH2|FHCB1|FHCB2
Descriptionlow density lipoprotein receptor adaptor protein 1
ReferenceMIM:605747|HGNC:HGNC:18640|Ensembl:ENSG00000157978|HPRD:05765|Vega:OTTHUMG00000007386
Gene typeprotein-coding
Map location1p36.11
Pascal p-value0.97
Sherlock p-value0.572
Fetal beta-1.13
DMG2 (# studies)
eGeneCaudate basal ganglia
Cerebellar Hemisphere
Cerebellum
Cortex
Hippocampus
Nucleus accumbens basal ganglia
Putamen basal ganglia
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:vanEijk_2014Genome-wide DNA methylation analysisThis dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 4
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 4
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg09261020125869937LDLRAP11.671E-4-0.4240.033DMG:Wockner_2014
cg20287514125869837LDLRAP13.754E-4-0.3550.043DMG:Wockner_2014
cg15662251126197855LDLRAP11.5E-67.907DMG:vanEijk_2014
cg04631202125942460LDLRAP11.048E-47.349DMG:vanEijk_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs6687849chr1175904808LDLRAP1261190.06trans
rs2502827chr1176044216LDLRAP1261190trans
rs17028363chr241913161LDLRAP1261190.1trans
rs16829545chr2151977407LDLRAP1261195.571E-19trans
rs16841750chr2158288461LDLRAP1261190.01trans
rs3845734chr2171125572LDLRAP1261190trans
rs16863816chr2177292762LDLRAP1261190.12trans
rs7584986chr2184111432LDLRAP1261196.207E-5trans
rs9810143chr35060209LDLRAP1261190trans
rs6797307chr38601563LDLRAP1261190.05trans
rs4240295chr4115550111LDLRAP1261190.07trans
rs2183142chr4159232695LDLRAP1261190.02trans
rs1396222chr4173279496LDLRAP1261190.13trans
rs335980chr4173329784LDLRAP1261190.07trans
rs2914204chr53470913LDLRAP1261190.16trans
rs17762315chr576807576LDLRAP1261190.1trans
rs10474151chr584286402LDLRAP1261190trans
rs11738579chr595119841LDLRAP1261190.09trans
rs133604960LDLRAP1261190.02trans
rs12196880chr624313746LDLRAP1261190.18trans
rs10806988chr624341768LDLRAP1261190.05trans
rs16890367chr638078448LDLRAP1261198.515E-4trans
rs7787830chr798797019LDLRAP1261190.06trans
rs6996695chr877540580LDLRAP1261190.02trans
rs3118341chr925185518LDLRAP1261195.46E-4trans
rs1126130chr925209346LDLRAP1261190.07trans
rs1998746chr925211761LDLRAP1261190.07trans
rs1332433chr925214440LDLRAP1261190.14trans
rs9406868chr925223372LDLRAP1261190.03trans
rs11139334chr984209393LDLRAP1261190.01trans
snp_a-21085300LDLRAP1261190.13trans
rs17176921chr1050580874LDLRAP1261190.1trans
rs7337967chr1353519044LDLRAP1261190.05trans
rs16955618chr1529937543LDLRAP1261192.641E-27trans
rs11873184chr181584081LDLRAP1261190.12trans
rs7274477chr201676942LDLRAP1261190.04trans
rs1041786chr2122617710LDLRAP1261195.477E-6trans
rs7288523chr2250082517LDLRAP1261190.18trans
rs16990575chrX32691327LDLRAP1261190.01trans
rs16993189chrX144666166LDLRAP1261190.06trans
rs12096438125889422LDLRAP1ENSG00000157978.72.323E-60.0119351gtex_brain_putamen_basal
rs6688931125889672LDLRAP1ENSG00000157978.78.619E-70.0119601gtex_brain_putamen_basal
rs4523506125893221LDLRAP1ENSG00000157978.73.406E-60.0123150gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0030276clathrin bindingIDASynap (GO term level: 4)12451172 
GO:0001784phosphotyrosine bindingIDA12451172 
GO:0005515protein bindingIEA-
GO:0008022protein C-terminus bindingIPI12221107 
GO:0015460transport accessory protein activityNAS12451172 
GO:0030674protein binding, bridgingNAS12451172 
GO:0030159receptor signaling complex scaffold activityIMP15166224 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008202steroid metabolic processIEA-
GO:0008203cholesterol metabolic processNAS12451172 
GO:0006629lipid metabolic processIEA-
GO:0006897endocytosisIEA-
GO:0048260positive regulation of receptor-mediated endocytosisIMP15166224 
GO:0043393regulation of protein bindingIMP15166224 
GO:0042632cholesterol homeostasisIEA-
GO:0042632cholesterol homeostasisNAS12451172 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolIDA12451172 
GO:0005737cytoplasmIEA-
GO:0005769early endosomeIDA14528014 
GO:0005769early endosomeIEA-
GO:0030121AP-1 adaptor complexIDA12451172 
GO:0030122AP-2 adaptor complexIDA12451172 
GO:0030122AP-2 adaptor complexIPI12221107 
GO:0009925basal plasma membraneIDA12451172 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG ENDOCYTOSIS 183132All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS 478302All SZGR 2.0 genes in this pathway
REACTOME LIPID DIGESTION MOBILIZATION AND TRANSPORT 4637All SZGR 2.0 genes in this pathway
REACTOME LIPOPROTEIN METABOLISM 2824All SZGR 2.0 genes in this pathway
REACTOME CHYLOMICRON MEDIATED LIPID TRANSPORT 1615All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN 384220All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN 187115All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 14699All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284156All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN 226132All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142669All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612367All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN 800473All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174695All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487303All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 482296All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229713All SZGR 2.0 genes in this pathway
LEE EARLY T LYMPHOCYTE DN 5736All SZGR 2.0 genes in this pathway
LEE NAIVE T LYMPHOCYTE 1910All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210725All SZGR 2.0 genes in this pathway
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE 10176All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50611691175m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-17-5p/20/93.mr/106/519.d6086151A,m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-29654660m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-494114811541Ahsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-9355361m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA