Summary ?
GeneID26249
SymbolKLHL3
SynonymsPHA2D
Descriptionkelch like family member 3
ReferenceMIM:605775|HGNC:HGNC:6354|Ensembl:ENSG00000146021|HPRD:09011|Vega:OTTHUMG00000129155
Gene typeprotein-coding
Map location5q31
Pascal p-value0.028
Sherlock p-value0.194
Fetal beta-0.591
DMG1 (# studies)
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IGenome scan meta-analysisPsr: 0.0032 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg096777415137071648KLHL33.516E-40.4610.042DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs16829545chr2151977407KLHL3262490trans
rs7584986chr2184111432KLHL3262490.01trans
rs10063752chr5109259572KLHL3262490.11trans
rs1030663chr5109263809KLHL3262490.15trans
rs16955618chr1529937543KLHL3262493.502E-8trans
rs1041786chr2122617710KLHL3262490.01trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingIEA-
GO:0005515protein bindingIEA-
GO:0005198structural molecule activityTAS10843806 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
ZHOU INFLAMMATORY RESPONSE LIVE UP 485293All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS RED DN 2519All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP 544308All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174695All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769437All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN 15093All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN 14588All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS 289187All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-149294129481A,m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-15038283834m8hsa-miR-150UCUCCCAACCCUUGUACCAGUG
miR-153282728341A,m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-18337773783m8hsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-1863863921Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-19924172423m8hsa-miR-199aCCCAGUGUUCAGACUACCUGUUC
hsa-miR-199bCCCAGUGUUUAGACUAUCUGUUC
miR-200bc/429279227991A,m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-24293929461A,m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-369-3p27942800m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-377366372m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-381292929351Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-448279828041Ahsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-9884890m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-93.hd/291-3p/294/295/302/372/373/52040024008m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU