SZGR2

Summary ?

GeneID	26585
Symbol	GREM1
Synonyms	C15DUPq\|CKTSF1B1\|CRAC1\|CRCS4\|DAND2\|DRM\|DUP15q\|GREMLIN\|HMPS\|HMPS1\|IHG-2\|MPSH\|PIG2
Description	gremlin 1, DAN family BMP antagonist
Reference	MIM:603054\|HGNC:HGNC:2001\|HPRD:07048\|
Gene type	protein-coding
Map location	15q13.3
Pascal p-value	0.005
Fetal beta	-0.5
eGene	Hippocampus Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description
CNV:YES	Copy number variation studies	Manual curation
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
GREM1	chr15	33023398	A	G	NM_001191322 NM_001191323 NM_013372	. . .	silent silent silent			Schizophrenia	DNM:Gulsuner_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16854353	chr1	179531607	GREM1	26585	0.11	trans
rs11120206	chr1	206610593	GREM1	26585	0.02	trans
rs11899693	chr2	64171418	GREM1	26585	0.01	trans
rs1527174	chr2	78146421	GREM1	26585	0.18	trans
rs1527175	chr2	78149450	GREM1	26585	0.18	trans
rs2729048	chr3	602688	GREM1	26585	0.01	trans
rs4144528	chr5	6841145	GREM1	26585	0.18	trans
rs9380492	chr6	35100415	GREM1	26585	0.07	trans
rs3800387	chr6	35186500	GREM1	26585	0.07	trans
rs12173582	chr6	35340299	GREM1	26585	0.07	trans
rs17075386	chr6	114025208	GREM1	26585	0.08	trans
rs17052544	chr6	114026836	GREM1	26585	0.08	trans
rs7805427	chr7	22103377	GREM1	26585	0.07	trans
rs6984890	chr8	61770963	GREM1	26585	0.04	trans
rs16924550	chr12	22174951	GREM1	26585	0.07	trans
rs17730330	chr12	92998513	GREM1	26585	0.08	trans
rs17076670	chr13	22952101	GREM1	26585	0.01	trans
rs7319578	chr13	82129005	GREM1	26585	0	trans
rs17821412	chr16	57938754	GREM1	26585	0.01	trans
rs184583	chr19	30371589	GREM1	26585	0.11	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005125	cytokine activity	IEA		-
GO:0005515	protein binding	IPI		16545136
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	9660951
GO:0001658	ureteric bud branching	IEA		-
GO:0009954	proximal/distal pattern formation	IEA		-
GO:0007267	cell-cell signaling	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0007275	multicellular organismal development	TAS		9660951
GO:0030514	negative regulation of BMP signaling pathway	IEA		-
GO:0030326	embryonic limb morphogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005615	extracellular space	TAS		9660951

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
MAHADEVAN IMATINIB RESISTANCE UP	23	15	All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS UP	92	64	All SZGR 2.0 genes in this pathway
COWLING MYCN TARGETS	43	27	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP	256	159	All SZGR 2.0 genes in this pathway
ONDER CDH1 SIGNALING VIA CTNNB1	83	58	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN	234	137	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS DN	61	47	All SZGR 2.0 genes in this pathway
KUNINGER IGF1 VS PDGFB TARGETS DN	46	28	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D1	18	13	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
LABBE WNT3A TARGETS UP	112	71	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN	366	257	All SZGR 2.0 genes in this pathway
SCHRAETS MLL TARGETS DN	33	24	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP	84	60	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3	142	103	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER UP	288	168	All SZGR 2.0 genes in this pathway
NAKAYAMA FGF2 TARGETS	29	17	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA2 UP	87	50	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN	157	106	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP	121	70	All SZGR 2.0 genes in this pathway
WINZEN DEGRADED VIA KHSRP	100	70	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
ANASTASSIOU CANCER MESENCHYMAL TRANSITION SIGNATURE	64	40	All SZGR 2.0 genes in this pathway
DURAND STROMA NS UP	162	103	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway
NABA ECM AFFILIATED	171	89	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	2774	2781	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	2774	2781	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-137	2981	2988	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-181	2952	2958	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-23	2710	2717	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	2710	2717	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-27	2775	2781	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	2775	2781	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-323	2710	2716	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-543	2953	2959	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GREM1