Gene Page: INPP5J
Summary ?
GeneID | 27124 |
Symbol | INPP5J |
Synonyms | INPP5|PIB5PA|PIPP |
Description | inositol polyphosphate-5-phosphatase J |
Reference | MIM:606481|HGNC:HGNC:8956|Ensembl:ENSG00000185133|HPRD:07573|Vega:OTTHUMG00000151206 |
Gene type | protein-coding |
Map location | 22q12.2 |
Pascal p-value | 0.007 |
Sherlock p-value | 2.433E-5 |
Fetal beta | -1.078 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004437 | inositol or phosphatidylinositol phosphatase activity | IEA | - | |
GO:0004445 | inositol-polyphosphate 5-phosphatase activity | IEA | - | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0017124 | SH3 domain binding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001726 | ruffle | IDA | 12536145 | |
GO:0005737 | cytoplasm | IDA | 12536145 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME PHOSPHOLIPID METABOLISM | 198 | 112 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF PIPS AT THE PLASMA MEMBRANE | 31 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME PI METABOLISM | 48 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN | 114 | 58 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 BULK UP | 27 | 15 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO ESTRADIOL DN | 82 | 52 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER METASTASIS UP | 56 | 31 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BRAIN DN | 85 | 58 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE UP | 97 | 61 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION DN | 99 | 65 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K27ME3 | 54 | 32 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR DN | 91 | 56 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 166 | 172 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-15/16/195/424/497 | 75 | 81 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-219 | 171 | 178 | 1A,m8 | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-27 | 166 | 172 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.