Summary ?
GeneID27154
SymbolBRPF3
Synonyms-
Descriptionbromodomain and PHD finger containing 3
ReferenceMIM:616856|HGNC:HGNC:14256|Ensembl:ENSG00000096070|HPRD:16565|Vega:OTTHUMG00000014589
Gene typeprotein-coding
Map location6p21
Pascal p-value0.189
Sherlock p-value0.027
Fetal beta0.517
DMG1 (# studies)

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IGenome scan meta-analysisPsr: 0.033 
GSMA_IIEGenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg10562781636165204BRPF36.86E-8-0.0111.68E-5DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME RESPONSE TO ELEVATED PLATELET CYTOSOLIC CA2 8956All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS 466331All SZGR 2.0 genes in this pathway
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION 208138All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536332All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720440All SZGR 2.0 genes in this pathway
NIELSEN MALIGNAT FIBROUS HISTIOCYTOMA DN 1811All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321200All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/351370376m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-128121012161Ahsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-142-5p20172023m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-149150015071A,m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/4976286341Ahsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-1825615671Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-204/211151315201A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-21819841990m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-22420142020m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
miR-27121012171A,m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-3263994061A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-34/449142314301A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-5036286341Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
miR-913011307m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-965605671A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC