Summary ?
GeneID27246
SymbolRNF115
SynonymsBCA2|ZNF364
Descriptionring finger protein 115
ReferenceHGNC:HGNC:18154|HPRD:18328|
Gene typeprotein-coding
Map location1q21.1
Sherlock p-value0.809
Fetal beta-0.444
eGeneMyers' cis & trans

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CNV:YESCopy number variation studiesManual curation
CV:PGCnpGenome-wide Association StudyGWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs16829545chr2151977407RNF115272463.013E-4trans
rs16955618chr1529937543RNF115272460trans
rs6032295chr2044178138RNF115272460.05trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278748All SZGR 2.0 genes in this pathway
AMUNDSON RESPONSE TO ARSENITE 217143All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING UP 10176All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544307All SZGR 2.0 genes in this pathway
CHEN LVAD SUPPORT OF FAILING HEART UP 10369All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022619All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540340All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518299All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR DN 3619All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS DURATION CORR UP 97All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567365All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE 317190All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-151286292m8hsa-miR-151brainACUAGACUGAAGCUCCUUGAGG
miR-3772312371Ahsa-miR-377AUCACACAAAGGCAACUUUUGU