Gene Page: BHLHE22
Summary ?
| GeneID | 27319 |
| Symbol | BHLHE22 |
| Synonyms | BHLHB5|Beta3|CAGL85|TNRC20 |
| Description | basic helix-loop-helix family member e22 |
| Reference | MIM:613483|HGNC:HGNC:11963|Ensembl:ENSG00000180828|HPRD:16551|Vega:OTTHUMG00000164386 |
| Gene type | protein-coding |
| Map location | 8q13 |
| Pascal p-value | 0.008 |
| Fetal beta | 3.38 |
| DMG | 2 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg21008602 | 8 | 65492936 | BHLHE22 | 4.267E-4 | -0.46 | 0.045 | DMG:Wockner_2014 |
| cg15740363 | 8 | 65488839 | BHLHE22 | 5.14E-8 | -0.016 | 1.36E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016564 | transcription repressor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SAMOLS TARGETS OF KHSV MIRNAS DN | 62 | 35 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS F UP | 185 | 119 | All SZGR 2.0 genes in this pathway |
| DARWICHE SKIN TUMOR PROMOTER DN | 185 | 115 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK HIGH DN | 180 | 110 | All SZGR 2.0 genes in this pathway |
| DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| DAWSON METHYLATED IN LYMPHOMA TCL1 | 59 | 45 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
| STAEGE EWING FAMILY TUMOR | 33 | 22 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-136 | 1473 | 1479 | m8 | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
| miR-137 | 1145 | 1151 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-18 | 729 | 735 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-182 | 924 | 930 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-192/215 | 1604 | 1611 | 1A,m8 | hsa-miR-192 | CUGACCUAUGAAUUGACAGCC |
| hsa-miR-215 | AUGACCUAUGAAUUGACAGAC | ||||
| miR-320 | 1026 | 1032 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-376 | 603 | 609 | 1A | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-377 | 1310 | 1316 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| miR-378* | 1045 | 1051 | 1A | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
| hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
| miR-381 | 613 | 619 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-486 | 1056 | 1062 | 1A | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| miR-493-5p | 1242 | 1248 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-495 | 1321 | 1327 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.