Summary ?
GeneID2742
SymbolGLRA2
SynonymsGLR
Descriptionglycine receptor alpha 2
ReferenceMIM:305990|HGNC:HGNC:4327|Ensembl:ENSG00000101958|HPRD:02379|Vega:OTTHUMG00000021166
Gene typeprotein-coding
Map locationXp22.2
Fetal beta3.12
SupportPotential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0030594neurotransmitter receptor activityIEANeurotransmitter (GO term level: 5)-
GO:0004890GABA-A receptor activityIEAGABA (GO term level: 7)-
GO:0004891glycine-inhibited chloride channel activityTAS2155780 
GO:0005216ion channel activityIEA-
GO:0005230extracellular ligand-gated ion channel activityIEA-
GO:0016934extracellular-glycine-gated chloride channel activityIDA2155780 
GO:0016594glycine bindingIDA2155780 
GO:0031404chloride ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007218neuropeptide signaling pathwayIDANeurotransmitter (GO term level: 8)2155780 
GO:0006821chloride transportIEA-
GO:0006811ion transportIDA2155780 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneNAS2155780 
GO:0030054cell junctionIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272195All SZGR 2.0 genes in this pathway
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES 413270All SZGR 2.0 genes in this pathway
REACTOME ION CHANNEL TRANSPORT 5542All SZGR 2.0 genes in this pathway
REACTOME LIGAND GATED ION CHANNEL TRANSPORT 2121All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL UP 13378All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK 423265All SZGR 2.0 genes in this pathway
HASLINGER B CLL WITH 11Q23 DELETION 2318All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244165All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS 8255All SZGR 2.0 genes in this pathway
LEIN PONS MARKERS 8959All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE DN 6948All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES 462273All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516308All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-10110961102m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-103/107527533m8hsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-128109811041Ahsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-1335065121Ahsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-1369199251Ahsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-142-5p68741Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-200bc/429911917m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-224863869m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
miR-2710981104m8hsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-3259951001m8hsa-miR-325CCUAGUAGGUGUCCAGUAAGUGU
miR-329927933m8hsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-3785195251Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-4945885941Ahsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-544203209m8hsa-miR-544AUUCUGCAUUUUUAGCAAGU