Gene Page: MAT2B
Summary ?
GeneID | 27430 |
Symbol | MAT2B |
Synonyms | MAT-II|MATIIbeta|Nbla02999|SDR23E1|TGR |
Description | methionine adenosyltransferase 2B |
Reference | MIM:605527|HGNC:HGNC:6905|Ensembl:ENSG00000038274|HPRD:05701|Vega:OTTHUMG00000130379 |
Gene type | protein-coding |
Map location | 5q34 |
Pascal p-value | 0.131 |
Fetal beta | -1.037 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg14103574 | 5 | 162932455 | MAT2B | 1.06E-7 | -0.011 | 2.32E-5 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1561519 | chr2 | 35823020 | MAT2B | 27430 | 0.17 | trans | ||
rs7591339 | chr2 | 35825597 | MAT2B | 27430 | 0.17 | trans | ||
rs7570146 | chr2 | 35844751 | MAT2B | 27430 | 0.17 | trans | ||
rs1439691 | chr2 | 35851281 | MAT2B | 27430 | 0.17 | trans | ||
rs3769074 | chr2 | 238646252 | MAT2B | 27430 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003824 | catalytic activity | IEA | - | |
GO:0005515 | protein binding | IPI | 10644686 | |
GO:0005515 | protein binding | ISS | - | |
GO:0008831 | dTDP-4-dehydrorhamnose reductase activity | IEA | - | |
GO:0048270 | methionine adenosyltransferase regulator activity | IDA | 10644686 | |
GO:0048270 | methionine adenosyltransferase regulator activity | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008152 | metabolic process | IEA | - | |
GO:0006730 | one-carbon compound metabolic process | IEA | - | |
GO:0006556 | S-adenosylmethionine biosynthetic process | IDA | 10644686 | |
GO:0006556 | S-adenosylmethionine biosynthetic process | ISS | - | |
GO:0045226 | extracellular polysaccharide biosynthetic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IC | 10644686 | |
GO:0005634 | nucleus | IDA | 11256614 | |
GO:0048269 | methionine adenosyltransferase complex | IDA | 10644686 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CYSTEINE AND METHIONINE METABOLISM | 34 | 24 | All SZGR 2.0 genes in this pathway |
KEGG SELENOAMINO ACID METABOLISM | 26 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SULFUR AMINO ACID METABOLISM | 24 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME BIOLOGICAL OXIDATIONS | 139 | 91 | All SZGR 2.0 genes in this pathway |
REACTOME PHASE II CONJUGATION | 70 | 42 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
CHOI ATL CHRONIC VS ACUTE DN | 18 | 10 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP | 117 | 84 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
JOHANSSON GLIOMAGENESIS BY PDGFB DN | 21 | 16 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
JOHANSSON BRAIN CANCER EARLY VS LATE DN | 45 | 35 | All SZGR 2.0 genes in this pathway |
LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE UP | 38 | 29 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
KEEN RESPONSE TO ROSIGLITAZONE DN | 106 | 68 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA NEURAL | 129 | 85 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
KRIEG KDM3A TARGETS NOT HYPOXIA | 208 | 107 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 134 | 141 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-142-5p | 465 | 471 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-17-5p/20/93.mr/106/519.d | 52 | 58 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-485-3p | 82 | 88 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.