SZGR2

Summary ?

GeneID	2885
Symbol	GRB2
Synonyms	ASH\|EGFRBP-GRB2\|Grb3-3\|MST084\|MSTP084\|NCKAP2
Description	growth factor receptor bound protein 2
Reference	MIM:108355\|HGNC:HGNC:4566\|Ensembl:ENSG00000177885\|HPRD:00150\|Vega:OTTHUMG00000134332
Gene type	protein-coding
Map location	17q24-q25
Pascal p-value	0.212
Sherlock p-value	0.291
Fetal beta	0.509
DMG	1 (# studies)
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 17.4417

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09509576	17	73402025	GRB2	2.83E-8	-0.018	8.8E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PTPRN	0.96	0.96
PRRT3	0.94	0.92
RASGRF1	0.93	0.89
SLC12A5	0.93	0.95
TRPM2	0.93	0.86
KCNJ9	0.93	0.90
DNM1	0.92	0.94
CLSTN1	0.92	0.89
CNNM1	0.92	0.92
NPTN	0.92	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C9orf46	-0.47	-0.45
C21orf57	-0.47	-0.43
BCL7C	-0.47	-0.50
RAB13	-0.46	-0.54
RPS20	-0.46	-0.53
GTF3C6	-0.45	-0.41
RPS6	-0.44	-0.44
RPL23A	-0.43	-0.46
RPS23	-0.43	-0.39
RPL24	-0.43	-0.41

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005154	epidermal growth factor receptor binding	IPI		12577067
GO:0005070	SH3/SH2 adaptor activity	TAS		8253073
GO:0043560	insulin receptor substrate binding	IPI		8388384
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007173	epidermal growth factor receptor signaling pathway	TAS		1322798
GO:0007267	cell-cell signaling	TAS		8253073
GO:0007265	Ras protein signal transduction	EXP		11520933
GO:0007265	Ras protein signal transduction	TAS		8253073
GO:0008286	insulin receptor signaling pathway	IPI		8388384
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IEA		-
GO:0005829	cytosol	EXP		7739560 \|8479541 \|8493579 \|8621719 \|8810325 \|9356464 \|9690470 \|10567358 \|10648629 \|10734310 \|10913131 \|11606067
GO:0005829	cytosol	TAS		14722116

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD	9516488
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Affinity Capture-Western	BioGRID	9407116
ACTA1	ACTA \| ASMA \| CFTD \| CFTD1 \| CFTDM \| MPFD \| NEM1 \| NEM2 \| NEM3	actin, alpha 1, skeletal muscle	Affinity Capture-MS	BioGRID	12577067
ADA	-	adenosine deaminase	-	HPRD	9299436
ADAM10	AD10 \| CD156c \| HsT18717 \| MADM \| kuz	ADAM metallopeptidase domain 10	Affinity Capture-Western	BioGRID	11741929
ADAM12	MCMP \| MCMPMltna \| MLTN \| MLTNA	ADAM metallopeptidase domain 12	-	HPRD	11127814
ADAM15	MDC15	ADAM metallopeptidase domain 15	-	HPRD,BioGRID	11741929
ADRB1	ADRB1R \| B1AR \| BETA1AR \| RHR	adrenergic, beta-1-, receptor	beta-1-AR interacts with Grb2.	BIND	9843378
ADRB2	ADRB2R \| ADRBR \| B2AR \| BAR \| BETA2AR	adrenergic, beta-2-, receptor, surface	-	HPRD,BioGRID	9830057
ALOX5	5-LO \| 5-LOX \| 5LPG \| LOG5 \| MGC163204	arachidonate 5-lipoxygenase	-	HPRD,BioGRID	7929073 \|8585605
ANXA2	ANX2 \| ANX2L4 \| CAL1H \| LIP2 \| LPC2 \| LPC2D \| P36 \| PAP-IV	annexin A2	-	HPRD,BioGRID	7510700
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	-	HPRD	12485888
ARHGAP17	DKFZp564A1363 \| FLJ37567 \| FLJ43368 \| MGC87805 \| MST066 \| MST110 \| MSTP038 \| MSTP066 \| MSTP110 \| NADRIN \| RICH1 \| WBP15	Rho GTPase activating protein 17	Reconstituted Complex	BioGRID	11431473
AXL	JTK11 \| UFO	AXL receptor tyrosine kinase	Axl interacts with an unspecified isoform of Grb2.	BIND	12470648
AXL	JTK11 \| UFO	AXL receptor tyrosine kinase	-	HPRD,BioGRID	9178760
BAT2	D6S51 \| D6S51E \| DKFZp686D09175 \| G2	HLA-B associated transcript 2	-	HPRD,BioGRID	14667819
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	-	HPRD	8649368 \|8700507
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	Affinity Capture-Western Reconstituted Complex	BioGRID	10085298 \|10822386
BCL2A1	ACC-1 \| ACC-2 \| BCL2L5 \| BFL1 \| GRS \| HBPA1	BCL2-related protein A1	-	HPRD	9670936
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Grb2 interacts with Bcr-Abl.	BIND	9872323
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	-	HPRD,BioGRID	8112292 \|9178913
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Tyrosine phosphorylated Bcr-Abl interacts with Grb2.	BIND	8112292
BLNK	BASH \| BLNK-S \| LY57 \| MGC111051 \| SLP-65 \| SLP65	B-cell linker	-	HPRD,BioGRID	9697839 \|9705962
CALD1	CDM \| H-CAD \| L-CAD \| MGC21352 \| NAG22	caldesmon 1	-	HPRD	10559276
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	Grb2 interacts with Cbl.	BIND	15782196
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	c-Cbl interacts with Grb2. This interaction was modeled on a demonstrated interaction between human c-Cbl and Grb2 from an unspecified species.	BIND	11053437
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	8083187 \|9108392 \|9174058 \|9178909 \|9367879 \|9461587 \|9872323 \|10086340 \|10204582 \|10570290 \|11964172 \|11997436
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD	9108392 \|9178909 \|11133830 \|11964172
CBLB	DKFZp686J10223 \| DKFZp779A0729 \| DKFZp779F1443 \| FLJ36865 \| FLJ41152 \| Nbla00127 \| RNF56	Cas-Br-M (murine) ecotropic retroviral transforming sequence b	-	HPRD,BioGRID	10086340
CCL5	D17S136E \| MGC17164 \| RANTES \| SCYA5 \| SISd \| TCP228	chemokine (C-C motif) ligand 5	-	HPRD	9009162
CD22	FLJ22814 \| MGC130020 \| SIGLEC-2 \| SIGLEC2	CD22 molecule	-	HPRD,BioGRID	11551923
CD28	MGC138290 \| Tp44	CD28 molecule	-	HPRD,BioGRID	7737275 \|8576157 \|9694876
CD2AP	CMS \| DKFZp586H0519	CD2-associated protein	-	HPRD	10339567
CD72	CD72b \| LYB2	CD72 molecule	-	HPRD	10820378
CDKN1B	CDKN4 \| KIP1 \| MEN1B \| MEN4 \| P27KIP1	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	-	HPRD,BioGRID	11278754
CHRM4	HM4	cholinergic receptor, muscarinic 4	M4 interacts with Grb2.	BIND	9843378
CLYBL	CLB \| bA134O15.1	citrate lyase beta like	Affinity Capture-MS	BioGRID	12577067
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	8662907 \|8810325 \|10970810
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	-	HPRD	8662907 \|10970810
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	-	HPRD,BioGRID	10477741
CSF1R	C-FMS \| CD115 \| CSFR \| FIM2 \| FMS	colony stimulating factor 1 receptor	-	HPRD,BioGRID	8262059 \|9178909 \|9380408
CSF3R	CD114 \| GCSFR	colony stimulating factor 3 receptor (granulocyte)	-	HPRD,BioGRID	9824671
CTTN	EMS1 \| FLJ34459	cortactin	-	HPRD	11439336
DAG1	156DAG \| A3a \| AGRNR \| DAG	dystroglycan 1 (dystrophin-associated glycoprotein 1)	-	HPRD,BioGRID	7744812
DCTN1	DAP-150 \| DP-150 \| HMN7B \| P135	dynactin 1 (p150, glued homolog, Drosophila)	-	HPRD,BioGRID	8955163
DNM1	DNM	dynamin 1	Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	8119878 \|9009162
DNM1	DNM	dynamin 1	-	HPRD	8119878 \|11877424
DOCK1	DOCK180 \| ced5	dedicator of cytokinesis 1	Co-fractionation Reconstituted Complex	BioGRID	8657152 \|12615911
DRD3	D3DR \| ETM1 \| FET1 \| MGC149204 \| MGC149205	dopamine receptor D3	D3 interacts with Grb2.	BIND	9843378
DRD3	D3DR \| ETM1 \| FET1 \| MGC149204 \| MGC149205	dopamine receptor D3	-	HPRD,BioGRID	11384839
DRD4	D4DR	dopamine receptor D4	D4.7 interacts with Grb2.	BIND	9843378
DRD4	D4DR	dopamine receptor D4	D4.4 interacts with Grb2.	BIND	9843378
DRD4	D4DR	dopamine receptor D4	-	HPRD,BioGRID	9843378
DRD4	D4DR	dopamine receptor D4	D4.2 interacts with Grb2.	BIND	9843378
DTX1	hDx-1	deltex homolog 1 (Drosophila)	-	HPRD,BioGRID	9590294
EGF	HOMG4 \| URG	epidermal growth factor (beta-urogastrone)	-	HPRD	10973965
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	GRB2 interacts with an unspecified isoform of EGFR. This interaction was modeled on a demonstrated interaction between human GRB2, and rat EGFR.	BIND	15782189
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD	1322798 \|7527043
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	EGFR interacts with GRB2.	BIND	8305738
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	1322798 \|7510700 \|7527043 \|8647858 \|9050991 \|10026169 \|10085134 \|11960376 \|12577067 \|16729043
ELK1	-	ELK1, member of ETS oncogene family	-	HPRD	8798570
EPHA2	ECK	EPH receptor A2	-	HPRD,BioGRID	12400011
EPHB1	ELK \| EPHT2 \| FLJ37986 \| Hek6 \| NET	EPH receptor B1	-	HPRD,BioGRID	8798570
EPOR	MGC138358	erythropoietin receptor	-	HPRD,BioGRID	7534299
EPPK1	EPIPL \| EPIPL1	epiplakin 1	Affinity Capture-MS	BioGRID	12577067
EPS15	AF-1P \| AF1P \| MLLT5	epidermal growth factor receptor pathway substrate 15	Far Western	BioGRID	7797522
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD	11173924 \|11606575\|11606575
ERBB2	CD340 \| HER-2 \| HER-2/neu \| HER2 \| NEU \| NGL \| TKR1	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)	-	HPRD,BioGRID	11606575
ERBB3	ErbB-3 \| HER3 \| LCCS2 \| MDA-BF-1 \| MGC88033 \| c-erbB-3 \| c-erbB3 \| erbB3-S \| p180-ErbB3 \| p45-sErbB3 \| p85-sErbB3	v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)	Affinity Capture-MS	BioGRID	16729043
ERBB4	HER4 \| MGC138404 \| p180erbB4	v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian)	Affinity Capture-MS	BioGRID	16729043
ETV6	TEL \| TEL/ABL	ets variant 6	Affinity Capture-Western Far Western	BioGRID	15143164
FASLG	APT1LG1 \| CD178 \| CD95L \| FASL \| TNFSF6	Fas ligand (TNF superfamily, member 6)	-	HPRD,BioGRID	11741599 \|12023017
FASLG	APT1LG1 \| CD178 \| CD95L \| FASL \| TNFSF6	Fas ligand (TNF superfamily, member 6)	CD95L interacts with Grb2.	BIND	12023017
FGFR1	BFGFR \| CD331 \| CEK \| FGFBR \| FLG \| FLJ99988 \| FLT2 \| HBGFR \| KAL2 \| N-SAM	fibroblast growth factor receptor 1	-	HPRD	9480847
FGFR3	ACH \| CD333 \| CEK2 \| HSFGFR3EX \| JTK4	fibroblast growth factor receptor 3	-	HPRD,BioGRID	9045692
FLT3	CD135 \| FLK2 \| STK1	fms-related tyrosine kinase 3	-	HPRD,BioGRID	10080542
FLT4	FLT41 \| LMPH1A \| PCL \| VEGFR3	fms-related tyrosine kinase 4	-	HPRD,BioGRID	7675451 \|7970715 \|8662748 \|9927207
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	Affinity Capture-Western Reconstituted Complex	BioGRID	8780727 \|9182757 \|10092678 \|11997436
FRS2	FRS2A \| FRS2alpha \| SNT \| SNT-1 \| SNT1	fibroblast growth factor receptor substrate 2	-	HPRD	8780727\|9182757\|11997436 \|12402043
FRS3	FRS2B \| FRS2beta \| MGC17167 \| SNT-2 \| SNT2	fibroblast growth factor receptor substrate 3	-	HPRD	11432792
GAB1	-	GRB2-associated binding protein 1	-	HPRD,BioGRID	11314042 \|11960376
GAB2	KIAA0571	GRB2-associated binding protein 2	Affinity Capture-Western Reconstituted Complex	BioGRID	10391903 \|11782427 \|15143164
GAB2	KIAA0571	GRB2-associated binding protein 2	-	HPRD	10068651 \|11882361
GAB3	-	GRB2-associated binding protein 3	-	HPRD,BioGRID	11739737
GHR	GHBP	growth hormone receptor	-	HPRD,BioGRID	9632636
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	7716522
GRB7	-	growth factor receptor-bound protein 7	-	HPRD	10377264
GRLF1	GRF-1 \| KIAA1722 \| MGC10745 \| P190-A \| P190A \| p190RhoGAP	glucocorticoid receptor DNA binding factor 1	Affinity Capture-Western	BioGRID	12441060
HCLS1	CTTNL \| HS1	hematopoietic cell-specific Lyn substrate 1	Reconstituted Complex	BioGRID	9670936
HNRNPC	C1 \| C2 \| HNRNP \| HNRPC \| MGC104306 \| MGC105117 \| MGC117353 \| MGC131677 \| SNRPC	heterogeneous nuclear ribonucleoprotein C (C1/C2)	-	HPRD,BioGRID	9516488
HRAS	C-BAS/HAS \| C-H-RAS \| C-HA-RAS1 \| CTLO \| H-RASIDX \| HAMSV \| HRAS1 \| K-RAS \| N-RAS \| RASH1	v-Ha-ras Harvey rat sarcoma viral oncogene homolog	-	HPRD	11352655
HTT	HD \| IT15	huntingtin	-	HPRD,BioGRID	9079622
HTT	HD \| IT15	huntingtin	HDP interacts with Grb2.	BIND	9079622
IL2RB	CD122 \| P70-75	interleukin 2 receptor, beta	-	HPRD,BioGRID	10602027
IL6ST	CD130 \| CDw130 \| GP130 \| GP130-RAPS \| IL6R-beta	interleukin 6 signal transducer (gp130, oncostatin M receptor)	Affinity Capture-Western Reconstituted Complex	BioGRID	9013873
INPP5D	MGC104855 \| MGC142140 \| MGC142142 \| SHIP \| SHIP1 \| SIP-145 \| hp51CN	inositol polyphosphate-5-phosphatase, 145kDa	-	HPRD,BioGRID	8723348
INSR	CD220 \| HHF5	insulin receptor	Affinity Capture-Western	BioGRID	9083103
IQGAP1	HUMORFA01 \| KIAA0051 \| SAR1 \| p195	IQ motif containing GTPase activating protein 1	Affinity Capture-MS	BioGRID	12577067
IRS1	HIRS-1	insulin receptor substrate 1	-	HPRD	7488107
IRS1	HIRS-1	insulin receptor substrate 1	Affinity Capture-Western Reconstituted Complex	BioGRID	8491186 \|8536716 \|12173038
IRS2	-	insulin receptor substrate 2	-	HPRD	9852124
IRS4	IRS-4 \| PY160	insulin receptor substrate 4	-	HPRD,BioGRID	9553137
ITGA2B	CD41 \| CD41B \| GP2B \| GPIIb \| GTA \| HPA3	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	-	HPRD,BioGRID	8631894 \|11964172
ITGA6	CD49f \| DKFZp686J01244 \| FLJ18737 \| ITGA6B \| VLA-6	integrin, alpha 6	-	HPRD	7556090
ITGB4	CD104	integrin, beta 4	-	HPRD	9171350
ITK	EMT \| LYK \| MGC126257 \| MGC126258 \| PSCTK2	IL2-inducible T-cell kinase	-	HPRD,BioGRID	10636929
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	-	HPRD,BioGRID	8536716 \|11527382
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	-	HPRD,BioGRID	7500025
JUB	Ajuba \| MGC15563	jub, ajuba homolog (Xenopus laevis)	-	HPRD	10330178
KDR	CD309 \| FLK1 \| VEGFR \| VEGFR2	kinase insert domain receptor (a type III receptor tyrosine kinase)	-	HPRD,BioGRID	10319320
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	-	HPRD	7799925 \|8576157 \|12112020
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	Affinity Capture-Western Reconstituted Complex	BioGRID	9872323 \|10467411 \|11960376
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	Grb2 interacts with Sam68.	BIND	9872323
KHDRBS2	FLJ38664 \| MGC26664 \| SLM-1 \| SLM1 \| bA535F17.1	KH domain containing, RNA binding, signal transduction associated 2	-	HPRD	10077576
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	Kit interacts with Grb2. This interaction was modeled on a demonstrated interaction between mouse proteins.	BIND	10022833
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	Grb2 interacts with c-Kit upon stimulation with SLF. This interaction was modeled on a demonstrated interaction between mouse Grb2 and human c-Kit.	BIND	7523381
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	-	HPRD,BioGRID	10377264
KRT17	K17 \| PC \| PC2 \| PCHC1	keratin 17	Affinity Capture-MS	BioGRID	12577067
KRT18	CYK18 \| K18	keratin 18	Affinity Capture-MS	BioGRID	12577067
KRT7	CK7 \| K2C7 \| K7 \| MGC129731 \| MGC3625 \| SCL	keratin 7	Affinity Capture-MS	BioGRID	12577067
KRT8	CARD2 \| CK8 \| CYK8 \| K2C8 \| K8 \| KO	keratin 8	Affinity Capture-MS	BioGRID	12577067
LAT	LAT1 \| pp36	linker for activation of T cells	-	HPRD	9489702 \|12359715
LAT	LAT1 \| pp36	linker for activation of T cells	Affinity Capture-Western Reconstituted Complex	BioGRID	9489702 \|11368773 \|12186560
LAT2	HSPC046 \| LAB \| NTAL \| WBSCR15 \| WBSCR5 \| WSCR5	linker for activation of T cells family, member 2	-	HPRD,BioGRID	12514734
LAX1	FLJ20340 \| LAX	lymphocyte transmembrane adaptor 1	-	HPRD,BioGRID	12359715
LCP2	SLP-76 \| SLP76	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	Affinity Capture-Western Reconstituted Complex	BioGRID	8695800 \|8995445 \|10204582 \|10224278 \|11314042
LY6G6F	C6orf21 \| G6f \| LY6G6D \| NG32	lymphocyte antigen 6 complex, locus G6F	-	HPRD,BioGRID	12852788
MAP2	DKFZp686I2148 \| MAP2A \| MAP2B \| MAP2C	microtubule-associated protein 2	-	HPRD,BioGRID	10781592 \|11546790\|11546790
MAP3K1	MAPKKK1 \| MEKK \| MEKK1	mitogen-activated protein kinase kinase kinase 1	Affinity Capture-Western Reconstituted Complex	BioGRID	9733714
MAP4K1	HPK1	mitogen-activated protein kinase kinase kinase kinase 1	-	HPRD,BioGRID	9346925 \|9788432 \|9891069
MAP4K1	HPK1	mitogen-activated protein kinase kinase kinase kinase 1	HPK1, a Ste-20 homologous serine/threonine kinase interacts with Grb2, an adaptor protein.	BIND	9891069
MAPK12	ERK3 \| ERK6 \| P38GAMMA \| PRKM12 \| SAPK-3 \| SAPK3	mitogen-activated protein kinase 12	-	HPRD	9019171
MAPK14	CSBP1 \| CSBP2 \| CSPB1 \| EXIP \| Mxi2 \| PRKM14 \| PRKM15 \| RK \| SAPK2A \| p38 \| p38ALPHA	mitogen-activated protein kinase 14	-	HPRD	8695800
MAPK9	JNK-55 \| JNK2 \| JNK2A \| JNK2ALPHA \| JNK2B \| JNK2BETA \| PRKM9 \| SAPK \| p54a \| p54aSAPK	mitogen-activated protein kinase 9	Reconstituted Complex	BioGRID	7642542 \|9019171
MED28	1500003D12Rik \| DKFZp434N185 \| EG1 \| magicin	mediator complex subunit 28	-	HPRD,BioGRID	15467741
MERTK	MER \| MGC133349 \| RP38 \| c-mer	c-mer proto-oncogene tyrosine kinase	-	HPRD	9891051
MET	AUTS9 \| HGFR \| RCCP2 \| c-Met	met proto-oncogene (hepatocyte growth factor receptor)	-	HPRD,BioGRID	7511210 \|8662889 \|9660480
MICAL1	DKFZp434B1517 \| FLJ11937 \| FLJ21739 \| MICAL \| MICAL-1 \| NICAL	microtubule associated monoxygenase, calponin and LIM domain containing 1	Reconstituted Complex	BioGRID	11827972
MST1R	CD136 \| CDw136 \| PTK8 \| RON	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	-	HPRD,BioGRID	8918464
MTA1	-	metastasis associated 1	-	HPRD	11483358
MTA3	KIAA1266	metastasis associated 1 family, member 3	-	HPRD	11483358
MUC1	CD227 \| EMA \| H23AG \| MAM6 \| PEM \| PEMT \| PUM	mucin 1, cell surface associated	-	HPRD,BioGRID	7664271
NCKIPSD	AF3P21 \| DIP \| DIP1 \| MGC23891 \| ORF1 \| SPIN90 \| WASLBP \| WISH	NCK interacting protein with SH3 domain	-	HPRD	11157975 \|11509578
NCKIPSD	AF3P21 \| DIP \| DIP1 \| MGC23891 \| ORF1 \| SPIN90 \| WASLBP \| WISH	NCK interacting protein with SH3 domain	-	HPRD,BioGRID	11157975
NEU3	FLJ12388 \| SIAL3	sialidase 3 (membrane sialidase)	-	HPRD,BioGRID	12730204
NTRK1	DKFZp781I14186 \| MTC \| TRK \| TRK1 \| TRKA \| p140-TrkA	neurotrophic tyrosine kinase, receptor, type 1	-	HPRD,BioGRID	10748052 \|11733534
OCRL	INPP5F \| LOCR \| NPHL2 \| OCRL1	oculocerebrorenal syndrome of Lowe	-	HPRD,BioGRID	9038219
PAG1	CBP \| FLJ37858 \| MGC138364 \| PAG	phosphoprotein associated with glycosphingolipid microdomains 1	-	HPRD,BioGRID	10790433
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	PAK1 interacts with Grb2.	BIND	12522133
PDE4D	DPDE3 \| HSPDE4D \| PDE4DN2 \| STRK1	phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)	PDE4D4 interacts with Grb2. This interaction was modelled on a demonstrated interaction between human PDE4D4 and Grb2 from an unspecified species.	BIND	10571082
PDE6G	DKFZp686C0587 \| MGC125749 \| PDEG	phosphodiesterase 6G, cGMP-specific, rod, gamma	-	HPRD,BioGRID	12624098
PDGFRA	CD140A \| MGC74795 \| PDGFR2 \| Rhe-PDGFRA	platelet-derived growth factor receptor, alpha polypeptide	Affinity Capture-Western	BioGRID	8943348
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	-	HPRD,BioGRID	7935391
PIK3C2B	C2-PI3K \| DKFZp686G16234	phosphoinositide-3-kinase, class 2, beta polypeptide	-	HPRD,BioGRID	11533253
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	p85 interacts with Grb2.	BIND	8662998
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD,BioGRID	7642542 \|7737969 \|7759531
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	-	HPRD	8662998
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	9281317
PLEC1	EBS1 \| EBSO \| HD1 \| PCN \| PLEC1b \| PLTN	plectin 1, intermediate filament binding protein 500kDa	Affinity Capture-MS	BioGRID	12577067
PRKAR1A	CAR \| CNC \| CNC1 \| DKFZp779L0468 \| MGC17251 \| PKR1 \| PPNAD1 \| PRKAR1 \| TSE1	protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)	-	HPRD,BioGRID	9050991
PRNP	ASCR \| CD230 \| CJD \| GSS \| MGC26679 \| PRIP \| PrP \| PrP27-30 \| PrP33-35C \| PrPc \| prion	prion protein	-	HPRD	11571277
PSMD10	dJ889N15.2 \| p28	proteasome (prosome, macropain) 26S subunit, non-ATPase, 10	-	HPRD	9009162
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Tyrosine-phosphorylated FAK interacts with Grb2.	BIND	7597091
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD	7997267
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Affinity Capture-Western Reconstituted Complex	BioGRID	8649427 \|10085298 \|10806474 \|12005431 \|12558988
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Grb2 interacts with FAK. This interaction was modeled on a demonstrated interaction between human Grb2 and mouse FAK.	BIND	9148935
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	10329689 \|10354709
PTPN1	PTP1B	protein tyrosine phosphatase, non-receptor type 1	-	HPRD	10660596 \|12388170
PTPN1	PTP1B	protein tyrosine phosphatase, non-receptor type 1	Reconstituted Complex	BioGRID	8940134 \|10660596
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	Affinity Capture-Western Far Western Reconstituted Complex	BioGRID	8041791 \|8702859 \|8995399 \|9362449 \|9632781 \|9824671 \|10080542 \|10212213 \|10747947
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD	8041791 \|8702859 \|12531430
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	Grb2 interacts with Syp via Syp SH2 domains.	BIND	7523381 \|8195176
PTPN12	PTP-PEST \| PTPG1	protein tyrosine phosphatase, non-receptor type 12	-	HPRD,BioGRID	9135065
PTPN22	LYP \| Lyp1 \| Lyp2 \| PEP \| PTPN8	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	-	HPRD,BioGRID	11882361
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	-	HPRD,BioGRID	11964172
PTPRA	HEPTP \| HLPR \| HPTPA \| HPTPalpha \| LRP \| PTPA \| PTPRL2 \| R-PTP-alpha \| RPTPA	protein tyrosine phosphatase, receptor type, A	An unspecified isoform of GRB2 interacts with PTPRA.	BIND	8670803
PTPRA	HEPTP \| HLPR \| HPTPA \| HPTPalpha \| LRP \| PTPA \| PTPRL2 \| R-PTP-alpha \| RPTPA	protein tyrosine phosphatase, receptor type, A	-	HPRD,BioGRID	7518772 \|8670803 \|11923305
PTPRC	B220 \| CD45 \| CD45R \| GP180 \| LCA \| LY5 \| T200	protein tyrosine phosphatase, receptor type, C	-	HPRD	8570203
PTPRE	DKFZp313F1310 \| FLJ57799 \| FLJ58245 \| HPTPE \| PTPE \| R-PTP-EPSILON	protein tyrosine phosphatase, receptor type, E	-	HPRD,BioGRID	10490839
PXN	FLJ16691	paxillin	Reconstituted Complex	BioGRID	10085298
RACGAP1	HsCYK-4 \| ID-GAP \| MgcRacGAP	Rac GTPase activating protein 1	Affinity Capture-MS	BioGRID	12577067
RALGPS1	KIAA0351 \| RALGEF2 \| RALGPS1A	Ral GEF with PH domain and SH3 binding motif 1	-	HPRD,BioGRID	10747847
RAPGEF1	C3G \| DKFZp781P1719 \| GRF2	Rap guanine nucleotide exchange factor (GEF) 1	-	HPRD,BioGRID	8621483
RAPSN	CMS1D \| CMS1E \| MGC3597 \| RNF205	receptor-associated protein of the synapse	-	HPRD	9856458
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	-	HPRD,BioGRID	12441060
REPS2	POB1	RALBP1 associated Eps domain containing 2	-	HPRD,BioGRID	9422736
RET	CDHF12 \| HSCR1 \| MEN2A \| MEN2B \| MTC1 \| PTC \| RET-ELE1 \| RET51	ret proto-oncogene	-	HPRD	9393871
RET	CDHF12 \| HSCR1 \| MEN2A \| MEN2B \| MTC1 \| PTC \| RET-ELE1 \| RET51	ret proto-oncogene	Reconstituted Complex	BioGRID	7665556 \|8183561
RHOU	ARHU \| CDC42L1 \| DJ646B12.2 \| FLJ10616 \| WRCH1 \| fJ646B12.2 \| hG28K	ras homolog gene family, member U	Wrch-1 interacts with Grb2. This interaction was modeled on a demonstrated interaction between human Wrch-1 and Grb2 from an unspecified species.	BIND	15556869
SELL	CD62L \| LAM-1 \| LAM1 \| LECAM1 \| LNHR \| LSEL \| LYAM1 \| Leu-8 \| Lyam-1 \| PLNHR \| TQ1 \| hLHRc	selectin L	-	HPRD,BioGRID	8986819
SGCA	50-DAG \| A2 \| ADL \| DAG2 \| DMDA2 \| LGMD2D \| SCARMD1 \| adhalin	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	-	HPRD	7744812
SH2B1	DKFZp547G1110 \| FLJ30542 \| KIAA1299 \| SH2-B \| SH2B	SH2B adaptor protein 1	-	HPRD,BioGRID	9856458
SH2B2	APS	SH2B adaptor protein 2	Affinity Capture-Western	BioGRID	9856458
SH2B3	CELIAC13 \| LNK	SH2B adaptor protein 3	-	HPRD,BioGRID	8649391
SH3BP2	3BP2 \| CRBM \| CRPM \| FLJ42079 \| RES4-23	SH3-domain binding protein 2	-	HPRD,BioGRID	9846481
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	-	HPRD	9507006\|11152963
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	SETA interacts with Grb2. This interaction was modelled on a demonstrated interaction between rat SETA and human Grb2	BIND	11152963
SH3KBP1	CIN85 \| GIG10 \| MIG18	SH3-domain kinase binding protein 1	Reconstituted Complex	BioGRID	10921882 \|11152963
SHB	RP11-3J10.8 \| bA3J10.2	Src homology 2 domain containing adaptor protein B	-	HPRD,BioGRID	9484780 \|10488157
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Affinity Capture-MS Affinity Capture-Western Co-fractionation Reconstituted Complex	BioGRID	7514169 \|7524086 \|7535773 \|8112292 \|8195171 \|8294403 \|8491186 \|8647288 \|8662733 \|9045692 \|9083103 \|9927207 \|10080542 \|10477741 \|10570290 \|11302736 \|11505033 \|11964172 \|12441060 \|12577067
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Shc interacts with Grb2. This interaction was modelled on a demonstrated interaction between Shc from human and Grb2 from rat and an unspecified species.	BIND	8084588
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	7524086 \|7535773 \|8491186 \|11707405
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	An unspecified isoform of Grb2 interacts with the p52 isoform of Shc.	BIND	9148935
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Grb2 interacts with Shc.	BIND	7515480 \|8112292 \|8939605 \|10891441
SHC3	N-Shc \| NSHC \| RAI \| SHCC	SHC (Src homology 2 domain containing) transforming protein 3	An unspecified isoform of GRB2 interacts with SHC3 (ShcC).	BIND	15735675
SHKBP1	PP203 \| Sb1	SH3KBP1 binding protein 1	-	HPRD,BioGRID	11152963
SIGLEC7	AIRM1 \| CD328 \| CDw328 \| D-siglec \| QA79 \| SIGLEC-7 \| p75 \| p75/AIRM1	sialic acid binding Ig-like lectin 7	-	HPRD	8188688
SIT1	MGC125908 \| MGC125909 \| MGC125910 \| RP11-331F9.5 \| SIT	signaling threshold regulating transmembrane adaptor 1	-	HPRD	11433379
SKAP1	SCAP1 \| SKAP55	src kinase associated phosphoprotein 1	-	HPRD,BioGRID	12171928
SNTA1	SNT1 \| TACIP1 \| dJ1187J4.5	syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component)	-	HPRD,BioGRID	11278583 \|11551227
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	Socs1 interacts with Grb2. This interaction was modeled on a demonstrated interaction between mouse Socs1 and human Grb2.	BIND	10022833
SOCS1	CIS1 \| CISH1 \| JAB \| SOCS-1 \| SSI-1 \| SSI1 \| TIP3	suppressor of cytokine signaling 1	-	HPRD,BioGRID	10022833
SOCS7	NAP4	suppressor of cytokine signaling 7	-	HPRD	9344857
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Grb2 interacts with Sos1. This interaction was modelled on a demonstrated interaction between rat Grb2 and Sos1.	BIND	8112292
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	-	HPRD	8479541 \|8493579
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Affinity Capture-MS Affinity Capture-Western Far Western Reconstituted Complex Two-hybrid	BioGRID	7510700 \|7514169 \|7629168 \|7664271 \|8112292 \|8188688 \|8479541 \|8695800 \|8810325 \|9009162 \|9344843 \|9872323 \|10207103 \|10319320 \|10477741 \|10570290 \|10716926 \|11960376 \|11964172 \|11997436 \|12577067
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	GRB2 interacts with SOS. This interaction was modeled on a demonstrated interaction between human GRB2 and mouse SOS.	BIND	7862111
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Sos1 interacts with Grb2. This interaction was modeled on a demonstrated interaction between Sos1 and Grb2 from Bos taurus.	BIND	9374537
SOS2	FLJ25596	son of sevenless homolog 2 (Drosophila)	-	HPRD,BioGRID	7629138 \|10940929
SPRY1	hSPRY1	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	-	HPRD	12402043
SPRY2	MGC23039 \| hSPRY2	sprouty homolog 2 (Drosophila)	-	HPRD,BioGRID	10940627 \|12402043
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	11964172
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	-	HPRD,BioGRID	11964172
SYN1	SYN1a \| SYN1b \| SYNI	synapsin I	-	HPRD	8022809
SYN1	SYN1a \| SYN1b \| SYNI	synapsin I	-	HPRD,BioGRID	8022809\|10899172
SYNCRIP	GRY-RBP \| HNRPQ1 \| NSAP1 \| RP1-3J17.2 \| dJ3J17.2 \| hnRNP-Q \| pp68	synaptotagmin binding, cytoplasmic RNA interacting protein	Reconstituted Complex	BioGRID	9341187
SYNJ2	INPP5H \| KIAA0348 \| MGC44422	synaptojanin 2	-	HPRD	9388224
SYP	-	synaptophysin	Affinity Capture-Western	BioGRID	7534299
TEK	CD202B \| TIE-2 \| TIE2 \| VMCM \| VMCM1	TEK tyrosine kinase, endothelial	-	HPRD	7478529 \|10521483
TFAP2A	AP-2 \| AP-2alpha \| AP2TF \| BOFS \| TFAP2	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	Affinity Capture-MS	BioGRID	12577067
TFAP2B	AP-2B \| AP2-B \| MGC21381	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	Affinity Capture-MS	BioGRID	12577067
TNFRSF1A	CD120a \| FPF \| MGC19588 \| TBP1 \| TNF-R \| TNF-R-I \| TNF-R55 \| TNFAR \| TNFR1 \| TNFR55 \| TNFR60 \| p55 \| p55-R \| p60	tumor necrosis factor receptor superfamily, member 1A	-	HPRD,BioGRID	10359574
TNK2	ACK \| ACK1 \| FLJ44758 \| FLJ45547 \| p21cdc42Hs	tyrosine kinase, non-receptor, 2	-	HPRD,BioGRID	8647288
TOM1L1	OK/KNS-CL.3 \| SRCASM	target of myb1 (chicken)-like 1	-	HPRD,BioGRID	11711534
TP63	AIS \| B(p51A) \| B(p51B) \| EEC3 \| KET \| LMS \| NBP \| OFC8 \| RHS \| SHFM4 \| TP53CP \| TP53L \| TP73L \| p40 \| p51 \| p53CP \| p63 \| p73H \| p73L	tumor protein p63	-	HPRD	8695800
TRAT1	HSPC062 \| TCRIM \| TRIM	T cell receptor associated transmembrane adaptor 1	Reconstituted Complex	BioGRID	10790433
TUB	rd5	tubby homolog (mouse)	-	HPRD	10455176
USP6NL	KIAA0019 \| RNTRE \| TRE2NL	USP6 N-terminal like	Grb2 interacts with RN-tre.	BIND	12399475
USP6NL	KIAA0019 \| RNTRE \| TRE2NL	USP6 N-terminal like	-	HPRD,BioGRID	12399475
USP8	FLJ34456 \| HumORF8 \| KIAA0055 \| MGC129718 \| UBPY	ubiquitin specific peptidase 8	-	HPRD,BioGRID	10982817 \|13129930
VAV1	VAV	vav 1 guanine nucleotide exchange factor	-	HPRD,BioGRID	7809090
VAV1	VAV	vav 1 guanine nucleotide exchange factor	Grb2 interacts with Vav	BIND	9013873
VAV2	-	vav 2 guanine nucleotide exchange factor	-	HPRD,BioGRID	11606575
VAV3	FLJ40431	vav 3 guanine nucleotide exchange factor	-	HPRD,BioGRID	11094073
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	Affinity Capture-Western Reconstituted Complex	BioGRID	8805332 \|9307968
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	-	HPRD	9307968 \|10224664
WASF1	FLJ31482 \| KIAA0269 \| SCAR1 \| WAVE \| WAVE1	WAS protein family, member 1	-	HPRD	9307968
WASF2	SCAR2 \| WAVE2 \| dJ393P12.2	WAS protein family, member 2	-	HPRD	9307968
WASL	DKFZp779G0847 \| MGC48327 \| N-WASP \| NWASP	Wiskott-Aldrich syndrome-like	-	HPRD,BioGRID	10087612 \|10781580
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	Affinity Capture-Western	BioGRID	7629168

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG DORSO VENTRAL AXIS FORMATION	25	21	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG JAK STAT SIGNALING PATHWAY	155	105	All SZGR 2.0 genes in this pathway
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG B CELL RECEPTOR SIGNALING PATHWAY	75	56	All SZGR 2.0 genes in this pathway
KEGG FC EPSILON RI SIGNALING PATHWAY	79	58	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG GNRH SIGNALING PATHWAY	101	77	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG RENAL CELL CARCINOMA	70	60	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
KEGG GLIOMA	65	56	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG ACUTE MYELOID LEUKEMIA	60	47	All SZGR 2.0 genes in this pathway
KEGG NON SMALL CELL LUNG CANCER	54	47	All SZGR 2.0 genes in this pathway
BIOCARTA SRCRPTP PATHWAY	11	9	All SZGR 2.0 genes in this pathway
BIOCARTA AT1R PATHWAY	36	28	All SZGR 2.0 genes in this pathway
BIOCARTA BCR PATHWAY	37	28	All SZGR 2.0 genes in this pathway
BIOCARTA BIOPEPTIDES PATHWAY	45	35	All SZGR 2.0 genes in this pathway
BIOCARTA CBL PATHWAY	13	10	All SZGR 2.0 genes in this pathway
BIOCARTA EGF PATHWAY	31	25	All SZGR 2.0 genes in this pathway
BIOCARTA EPO PATHWAY	19	13	All SZGR 2.0 genes in this pathway
BIOCARTA ERK PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA FCER1 PATHWAY	41	30	All SZGR 2.0 genes in this pathway
BIOCARTA GH PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1 PATHWAY	21	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL2 PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL3 PATHWAY	15	11	All SZGR 2.0 genes in this pathway
BIOCARTA IL4 PATHWAY	11	8	All SZGR 2.0 genes in this pathway
BIOCARTA IL6 PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL2RB PATHWAY	38	26	All SZGR 2.0 genes in this pathway
BIOCARTA GLEEVEC PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA INSULIN PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA INTEGRIN PATHWAY	38	29	All SZGR 2.0 genes in this pathway
BIOCARTA PYK2 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1R PATHWAY	23	20	All SZGR 2.0 genes in this pathway
BIOCARTA NGF PATHWAY	18	13	All SZGR 2.0 genes in this pathway
BIOCARTA P38MAPK PATHWAY	40	31	All SZGR 2.0 genes in this pathway
BIOCARTA PDGF PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA PTEN PATHWAY	18	14	All SZGR 2.0 genes in this pathway
BIOCARTA HER2 PATHWAY	22	17	All SZGR 2.0 genes in this pathway
BIOCARTA ERK5 PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA MET PATHWAY	37	30	All SZGR 2.0 genes in this pathway
BIOCARTA SPRY PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TCR PATHWAY	49	37	All SZGR 2.0 genes in this pathway
BIOCARTA CTLA4 PATHWAY	21	18	All SZGR 2.0 genes in this pathway
BIOCARTA TPO PATHWAY	24	17	All SZGR 2.0 genes in this pathway
BIOCARTA CREB PATHWAY	27	25	All SZGR 2.0 genes in this pathway
BIOCARTA TFF PATHWAY	21	15	All SZGR 2.0 genes in this pathway
BIOCARTA TRKA PATHWAY	12	10	All SZGR 2.0 genes in this pathway
SA B CELL RECEPTOR COMPLEXES	24	20	All SZGR 2.0 genes in this pathway
ST ERK1 ERK2 MAPK PATHWAY	32	25	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
ST G ALPHA I PATHWAY	35	29	All SZGR 2.0 genes in this pathway
SIG IL4RECEPTOR IN B LYPHOCYTES	27	23	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES	51	41	All SZGR 2.0 genes in this pathway
ST T CELL SIGNAL TRANSDUCTION	45	33	All SZGR 2.0 genes in this pathway
SIG BCR SIGNALING PATHWAY	46	38	All SZGR 2.0 genes in this pathway
ST B CELL ANTIGEN RECEPTOR	40	32	All SZGR 2.0 genes in this pathway
ST INTERLEUKIN 4 PATHWAY	26	18	All SZGR 2.0 genes in this pathway
SA PTEN PATHWAY	17	14	All SZGR 2.0 genes in this pathway
SA TRKA RECEPTOR	17	15	All SZGR 2.0 genes in this pathway
ST PHOSPHOINOSITIDE 3 KINASE PATHWAY	37	29	All SZGR 2.0 genes in this pathway
PID FCER1 PATHWAY	62	43	All SZGR 2.0 genes in this pathway
PID BCR 5PATHWAY	65	50	All SZGR 2.0 genes in this pathway
PID ERBB4 PATHWAY	38	32	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID GMCSF PATHWAY	37	31	All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY	65	43	All SZGR 2.0 genes in this pathway
PID TCR PATHWAY	66	51	All SZGR 2.0 genes in this pathway
PID ER NONGENOMIC PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID PTP1B PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID RET PATHWAY	39	29	All SZGR 2.0 genes in this pathway
PID CD8 TCR PATHWAY	53	42	All SZGR 2.0 genes in this pathway
PID TCPTP PATHWAY	43	33	All SZGR 2.0 genes in this pathway
PID ANGIOPOIETIN RECEPTOR PATHWAY	50	41	All SZGR 2.0 genes in this pathway
PID SHP2 PATHWAY	58	46	All SZGR 2.0 genes in this pathway
PID IL2 1PATHWAY	55	43	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID IL5 PATHWAY	14	11	All SZGR 2.0 genes in this pathway
PID IL2 PI3K PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID ERBB2 ERBB3 PATHWAY	44	35	All SZGR 2.0 genes in this pathway
PID IL3 PATHWAY	27	19	All SZGR 2.0 genes in this pathway
PID IL6 7 PATHWAY	47	40	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID NEPHRIN NEPH1 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
PID PDGFRA PATHWAY	22	18	All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID A6B1 A6B4 INTEGRIN PATHWAY	46	35	All SZGR 2.0 genes in this pathway
PID RAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
PID PI3K PLC TRK PATHWAY	36	31	All SZGR 2.0 genes in this pathway
PID EPHA2 FWD PATHWAY	19	16	All SZGR 2.0 genes in this pathway
PID LYMPH ANGIOGENESIS PATHWAY	25	16	All SZGR 2.0 genes in this pathway
PID FGF PATHWAY	55	37	All SZGR 2.0 genes in this pathway
PID FAK PATHWAY	59	45	All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY	55	38	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF	217	167	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY SCF KIT	78	59	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME SPRY REGULATION OF FGF SIGNALING	14	9	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME NEGATIVE REGULATION OF FGFR SIGNALING	37	24	All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF KIT SIGNALING	17	10	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4	90	67	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB2	101	78	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY CONSTITUTIVELY ACTIVE EGFR	18	13	All SZGR 2.0 genes in this pathway
REACTOME GRB2 EVENTS IN ERBB2 SIGNALING	22	20	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY EGFR IN CANCER	109	80	All SZGR 2.0 genes in this pathway
REACTOME SHC1 EVENTS IN ERBB4 SIGNALING	20	17	All SZGR 2.0 genes in this pathway
REACTOME PI3K EVENTS IN ERBB2 SIGNALING	44	34	All SZGR 2.0 genes in this pathway
REACTOME ANTIGEN ACTIVATES B CELL RECEPTOR LEADING TO GENERATION OF SECOND MESSENGERS	29	24	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR	126	90	All SZGR 2.0 genes in this pathway
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE	87	64	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING TO RAS	27	23	All SZGR 2.0 genes in this pathway
REACTOME CELL SURFACE INTERACTIONS AT THE VASCULAR WALL	91	65	All SZGR 2.0 genes in this pathway
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE	137	105	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING TO ERKS	36	30	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR IN DISEASE	127	88	All SZGR 2.0 genes in this pathway
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK	205	136	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR1 MUTANTS	30	20	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR1 FUSION MUTANTS	19	12	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR MUTANTS	44	29	All SZGR 2.0 genes in this pathway
REACTOME EGFR DOWNREGULATION	25	14	All SZGR 2.0 genes in this pathway
REACTOME GAB1 SIGNALOSOME	38	29	All SZGR 2.0 genes in this pathway
REACTOME SHC1 EVENTS IN EGFR SIGNALING	15	13	All SZGR 2.0 genes in this pathway
REACTOME TIE2 SIGNALING	17	13	All SZGR 2.0 genes in this pathway
REACTOME INTEGRIN CELL SURFACE INTERACTIONS	79	48	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME GRB2 SOS PROVIDES LINKAGE TO MAPK SIGNALING FOR INTERGRINS	15	10	All SZGR 2.0 genes in this pathway
REACTOME INTEGRIN ALPHAIIB BETA3 SIGNALING	27	17	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY PDGF	122	93	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION	95	76	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH	64	49	All SZGR 2.0 genes in this pathway
REACTOME CD28 CO STIMULATION	32	26	All SZGR 2.0 genes in this pathway
REACTOME CD28 DEPENDENT VAV1 PATHWAY	11	10	All SZGR 2.0 genes in this pathway
REACTOME COSTIMULATION BY THE CD28 FAMILY	63	48	All SZGR 2.0 genes in this pathway
REACTOME FRS2 MEDIATED CASCADE	36	27	All SZGR 2.0 genes in this pathway
REACTOME PI 3K CASCADE	56	39	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR	100	74	All SZGR 2.0 genes in this pathway
REACTOME SHC MEDIATED CASCADE	28	19	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ILS	107	86	All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF SIGNALING BY CBL	18	16	All SZGR 2.0 genes in this pathway
REACTOME IL 3 5 AND GM CSF SIGNALING	43	34	All SZGR 2.0 genes in this pathway
REACTOME IL RECEPTOR SHC SIGNALING	27	21	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL REGULATORY PROTEIN SIRP FAMILY INTERACTIONS	12	10	All SZGR 2.0 genes in this pathway
REACTOME IL 2 SIGNALING	41	34	All SZGR 2.0 genes in this pathway
REACTOME PLATELET AGGREGATION PLUG FORMATION	36	23	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY INSULIN RECEPTOR	108	72	All SZGR 2.0 genes in this pathway
REACTOME SIGNAL ATTENUATION	14	8	All SZGR 2.0 genes in this pathway
REACTOME SOS MEDIATED SIGNALLING	14	13	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
REACTOME SHC MEDIATED SIGNALLING	15	12	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME ADAPTIVE IMMUNE SYSTEM	539	350	All SZGR 2.0 genes in this pathway
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM	270	204	All SZGR 2.0 genes in this pathway
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION	208	138	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY FGFR	112	80	All SZGR 2.0 genes in this pathway
REACTOME PI3K CASCADE	71	51	All SZGR 2.0 genes in this pathway
REACTOME SHC RELATED EVENTS	17	13	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS TOP50 UP	38	27	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE DN	98	59	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON	335	181	All SZGR 2.0 genes in this pathway
BROCKE APOPTOSIS REVERSED BY IL6	144	98	All SZGR 2.0 genes in this pathway
KAAB FAILED HEART ATRIUM DN	141	99	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS DN	57	39	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
MACLACHLAN BRCA1 TARGETS DN	16	12	All SZGR 2.0 genes in this pathway
ZHANG PROLIFERATING VS QUIESCENT	51	41	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C4	18	12	All SZGR 2.0 genes in this pathway
HEDENFALK BREAST CANCER BRCA1 VS BRCA2	163	113	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP	113	71	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER PROGRESSION UP	20	14	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
ALONSO METASTASIS UP	198	128	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP	165	118	All SZGR 2.0 genes in this pathway
HUNSBERGER EXERCISE REGULATED GENES	31	26	All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER UP	288	168	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO METHOTREXATE	18	9	All SZGR 2.0 genes in this pathway
SUBTIL PROGESTIN TARGETS	36	25	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP	271	165	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
ZHANG ADIPOGENESIS BY BMP7	14	12	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	996	1002	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	996	1002	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	2260	2266	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	2260	2266	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-141/200a	2190	2196	m8	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	2190	2196	m8	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-153	375	382	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	183	189	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-27	2260	2267	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	2260	2267	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-320	1232	1239	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-329	2165	2171	1A	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-376c	2208	2214	1A	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-433-3p	2137	2144	1A,m8	hsa-miR-433^brain	AUCAUGAUGGGCUCCUCGGUGU
miR-448	376	382	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-96	183	189	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GRB2