Gene Page: GRB10
Summary ?
GeneID | 2887 |
Symbol | GRB10 |
Synonyms | GRB-IR|Grb-10|IRBP|MEG1|RSS |
Description | growth factor receptor bound protein 10 |
Reference | MIM:601523|HGNC:HGNC:4564|Ensembl:ENSG00000106070|HPRD:03312|Vega:OTTHUMG00000150622 |
Gene type | protein-coding |
Map location | 7p12.2 |
Pascal p-value | 0.005 |
Fetal beta | -0.079 |
Support | G2Cdb.humanPSD G2Cdb.humanPSP Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0161 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MLL2 | 0.83 | 0.86 |
PRICKLE2 | 0.83 | 0.85 |
RAPH1 | 0.83 | 0.86 |
C12orf51 | 0.82 | 0.84 |
RNF150 | 0.82 | 0.84 |
TANC2 | 0.82 | 0.85 |
KIAA2018 | 0.81 | 0.83 |
XKR4 | 0.80 | 0.85 |
SOCS7 | 0.80 | 0.84 |
CUGBP2 | 0.80 | 0.81 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SERPINB6 | -0.58 | -0.70 |
RHOC | -0.54 | -0.69 |
BDH2 | -0.51 | -0.62 |
FXYD1 | -0.51 | -0.66 |
TLCD1 | -0.50 | -0.66 |
DCXR | -0.50 | -0.62 |
DBI | -0.50 | -0.69 |
S100A16 | -0.50 | -0.66 |
SAT1 | -0.50 | -0.71 |
AC021016.1 | -0.50 | -0.66 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005070 | SH3/SH2 adaptor activity | TAS | 9006901 | |
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 8798570 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007267 | cell-cell signaling | TAS | 9006901 | |
GO:0007165 | signal transduction | IEA | - | |
GO:0008286 | insulin receptor signaling pathway | TAS | 9006901 | |
GO:0048009 | insulin-like growth factor receptor signaling pathway | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | TAS | 9006901 | |
GO:0005886 | plasma membrane | TAS | 9006901 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABL1 | ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl | c-abl oncogene 1, receptor tyrosine kinase | Affinity Capture-Western Reconstituted Complex | BioGRID | 9006901 |9747873 |
AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | - | HPRD | 11809791 |
BCR | ALL | BCR-ABL1 | BCR1 | CML | D22S11 | D22S662 | FLJ16453 | PHL | breakpoint cluster region | - | HPRD,BioGRID | 9747873 |
EGFR | ERBB | ERBB1 | HER1 | PIG61 | mENA | epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | Grb10 interacts with EGFR. | BIND | 9506989 |
EGFR | ERBB | ERBB1 | HER1 | PIG61 | mENA | epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | - | HPRD,BioGRID | 9006901 |9506989 |
ELK1 | - | ELK1, member of ETS oncogene family | - | HPRD | 8798570 |
EPHB1 | ELK | EPHT2 | FLJ37986 | Hek6 | NET | EPH receptor B1 | Two-hybrid | BioGRID | 8798570 |
FYN | MGC45350 | SLK | SYN | FYN oncogene related to SRC, FGR, YES | - | HPRD,BioGRID | 10871840 |
GHR | GHBP | growth hormone receptor | - | HPRD,BioGRID | 9632636 |
GIGYF1 | GYF1 | PERQ1 | GRB10 interacting GYF protein 1 | - | HPRD,BioGRID | 12771153 |
GIGYF2 | DKFZp686I15154 | DKFZp686J17223 | FLJ23368 | GYF2 | KIAA0642 | PARK11 | PERQ2 | PERQ3 | TNRC15 | GRB10 interacting GYF protein 2 | - | HPRD,BioGRID | 12771153 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | - | HPRD | 8621530 |8764099 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | Grb10 interacts with IGFIR. | BIND | 9506989 |
IGF1R | CD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216 | insulin-like growth factor 1 receptor | Affinity Capture-Western in vitro in vivo Reconstituted Complex Two-hybrid | BioGRID | 8764099 |8776723 |9506989 |12697834 |
INSR | CD220 | HHF5 | insulin receptor | Grb10 interacts with IR. | BIND | 9506989 |
INSR | CD220 | HHF5 | insulin receptor | - | HPRD,BioGRID | 7479769 |8621530 |
IRS1 | HIRS-1 | insulin receptor substrate 1 | Reconstituted Complex | BioGRID | 8621530 |
JAK2 | JTK10 | Janus kinase 2 (a protein tyrosine kinase) | - | HPRD,BioGRID | 9632636 |
KDR | CD309 | FLK1 | VEGFR | VEGFR2 | kinase insert domain receptor (a type III receptor tyrosine kinase) | - | HPRD,BioGRID | 11494124 |
KIT | C-Kit | CD117 | PBT | SCFR | v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog | - | HPRD,BioGRID | 11809791 |
MAP2K1 | MAPKK1 | MEK1 | MKK1 | PRKMK1 | mitogen-activated protein kinase kinase 1 | - | HPRD,BioGRID | 9553107 |
MEGF10 | DKFZp781K1852 | FLJ41574 | KIAA1780 | multiple EGF-like-domains 10 | - | HPRD | 12421765 |
NEDD4 | KIAA0093 | MGC176705 | NEDD4-1 | RPF1 | neural precursor cell expressed, developmentally down-regulated 4 | - | HPRD | 12697834 |
NEDD4 | KIAA0093 | MGC176705 | NEDD4-1 | RPF1 | neural precursor cell expressed, developmentally down-regulated 4 | - | HPRD | 10446181 |12697834|12697834 |
PDGFRB | CD140B | JTK12 | PDGF-R-beta | PDGFR | PDGFR1 | platelet-derived growth factor receptor, beta polypeptide | - | HPRD | 9006901 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | - | HPRD,BioGRID | 9553107 |10585452 |
RET | CDHF12 | HSCR1 | MEN2A | MEN2B | MTC1 | PTC | RET-ELE1 | RET51 | ret proto-oncogene | - | HPRD,BioGRID | 7665556 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | Biochemical Activity | BioGRID | 10871840 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID INSULIN PATHWAY | 45 | 32 | All SZGR 2.0 genes in this pathway |
PID RET PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
PID IGF1 PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID KIT PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY SCF KIT | 78 | 59 | All SZGR 2.0 genes in this pathway |
REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNAL ATTENUATION | 14 | 8 | All SZGR 2.0 genes in this pathway |
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN | 92 | 51 | All SZGR 2.0 genes in this pathway |
PRAMOONJAGO SOX4 TARGETS UP | 52 | 38 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
LIU VMYB TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER BASAL VS MESENCHYMAL DN | 50 | 36 | All SZGR 2.0 genes in this pathway |
DITTMER PTHLH TARGETS UP | 112 | 68 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 DN | 229 | 142 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 6 7WK UP | 197 | 135 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
WANG HCP PROSTATE CANCER | 111 | 69 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
GOUYER TUMOR INVASIVENESS | 9 | 5 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 MCF10A | 43 | 26 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH PML RARA FUSION | 77 | 62 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
ALCALAY AML BY NPM1 LOCALIZATION UP | 140 | 83 | All SZGR 2.0 genes in this pathway |
MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
XU RESPONSE TO TRETINOIN AND NSC682994 DN | 15 | 12 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
BRACHAT RESPONSE TO CAMPTOTHECIN UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
CHIBA RESPONSE TO TSA DN | 23 | 14 | All SZGR 2.0 genes in this pathway |
JACKSON DNMT1 TARGETS DN | 25 | 21 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 2 | 29 | 14 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS INTERFERON DN | 52 | 30 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
FONTAINE THYROID TUMOR UNCERTAIN MALIGNANCY UP | 36 | 23 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION TOP20 DN | 18 | 12 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
BRIDEAU IMPRINTED GENES | 63 | 47 | All SZGR 2.0 genes in this pathway |
ZHANG ADIPOGENESIS BY BMP7 | 14 | 12 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 2338 | 2344 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-181 | 2320 | 2327 | 1A,m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-199 | 39 | 46 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-30-5p | 367 | 373 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.