SZGR2

Summary ?

GeneID	2911
Symbol	GRM1
Synonyms	GPRC1A\|MGLU1\|MGLUR1\|PPP1R85\|SCAR13
Description	glutamate receptor, metabotropic 1
Reference	MIM:604473\|HGNC:HGNC:4593\|Ensembl:ENSG00000152822\|HPRD:05129\|Vega:OTTHUMG00000015752
Gene type	protein-coding
Map location	6q24
Pascal p-value	0.091
Sherlock p-value	0.161
Fetal beta	-0.93
DMG	1 (# studies)
eGene	Meta
Support	GPCR SIGNALLING METABOTROPIC GLUTAMATE RECEPTOR G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0024

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13371951	6	146350041	GRM1	1.807E-4	0.445	0.034	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9076744
GO:0007186	G-protein coupled receptor protein signaling pathway	IEA		-
GO:0007186	G-protein coupled receptor protein signaling pathway	TAS		7476890
GO:0007165	signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		7476890

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG LONG TERM POTENTIATION	70	57	All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION	70	53	All SZGR 2.0 genes in this pathway
BIOCARTA CK1 PATHWAY	17	17	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME CLASS C 3 METABOTROPIC GLUTAMATE PHEROMONE RECEPTORS	15	11	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE DN	261	183	All SZGR 2.0 genes in this pathway
HILLION HMGA1 TARGETS	90	71	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL	129	85	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1019	1025	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124.1	151	158	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	151	158	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	151	157	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-139	1020	1026	m8	hsa-miR-139^brain	UCUACAGUGCACGUGUCU
miR-144	1019	1025	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-204/211	245	252	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	245	252	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-218	261	268	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-221/222	1022	1028	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	1022	1028	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-34b	2746	2752	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-381	1229	1236	1A,m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-539	2025	2032	1A,m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU
miR-96	949	955	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GRM1