Summary ?
GeneID2925
SymbolGRPR
SynonymsBB2
Descriptiongastrin releasing peptide receptor
ReferenceMIM:305670|HGNC:HGNC:4609|HPRD:02376|
Gene typeprotein-coding
Map locationXp22.2
SupportPotential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0004946bombesin receptor activityIEA-
GO:0008528peptide receptor activity, G-protein coupledTAS7838118 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0007186G-protein coupled receptor protein signaling pathwayTAS1655761 
GO:0007165signal transductionIEA-
GO:0042127regulation of cell proliferationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneTAS7838118 
GO:0005887integral to plasma membraneTAS8391296 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG CALCIUM SIGNALING PATHWAY 178134All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272195All SZGR 2.0 genes in this pathway
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK 205136All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920449All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE LIGAND BINDING RECEPTORS 188108All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305177All SZGR 2.0 genes in this pathway
REACTOME G ALPHA Q SIGNALLING EVENTS 184116All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805368All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408246All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN 228114All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN 10677All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1864004061Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU