SZGR2

Summary ?

GeneID	2969
Symbol	GTF2I
Synonyms	BAP135\|BTKAP1\|DIWS\|GTFII-I\|IB291\|SPIN\|TFII-I\|WBS\|WBSCR6
Description	general transcription factor IIi
Reference	MIM:601679\|HGNC:HGNC:4659\|Ensembl:ENSG00000263001\|HPRD:03399\|Vega:OTTHUMG00000156237
Gene type	protein-coding
Map location	7q11.23
Pascal p-value	0.005

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 1.4695

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	NAS		9334314
GO:0005515	protein binding	IPI		9012831 \|15231747 \|17353931
GO:0016251	general RNA polymerase II transcription factor activity	TAS		9334314
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006367	transcription initiation from RNA polymerase II promoter	TAS		9334314
GO:0006350	transcription	IEA		-
GO:0007165	signal transduction	TAS		9012831
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AOF2	BHC110 \| KDM1 \| KIAA0601 \| LSD1	amine oxidase (flavin containing) domain 2	Affinity Capture-MS Affinity Capture-Western	BioGRID	12493763
ATF6	ATF6A	activating transcription factor 6	Affinity Capture-Western	BioGRID	11287625
BTK	AGMX1 \| AT \| ATK \| BPK \| IMD1 \| MGC126261 \| MGC126262 \| PSCTK1 \| XLA	Bruton agammaglobulinemia tyrosine kinase	-	HPRD,BioGRID	9012831 \|10373551 \|14623887
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	Affinity Capture-Western	BioGRID	12393887
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Affinity Capture-MS Affinity Capture-Western	BioGRID	12393887 \|12493763
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	HDAC3 interacts with TFII-I. This interaction was modeled on a demonstrated interaction between HDAC3 and TFII-I isoforms both from unspecified species.	BIND	12239342
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD,BioGRID	12239342 \|12393887
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	-	HPRD	12393887
LSM8	YJR022W	LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae)	-	HPRD,BioGRID	15231747
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	-	HPRD,BioGRID	10648599
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	-	HPRD,BioGRID	8377829
NFKB2	LYT-10 \| LYT10	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	-	HPRD	14743216
PHF21A	BHC80 \| BM-006 \| KIAA1696	PHD finger protein 21A	Affinity Capture-Western	BioGRID	12493763
PRKG1	CGKI \| DKFZp686K042 \| FLJ36117 \| MGC71944 \| PGK \| PKG \| PRKG1B \| PRKGR1B \| cGKI-BETA \| cGKI-alpha	protein kinase, cGMP-dependent, type I	-	HPRD,BioGRID	12082086
PRRX1	PHOX1 \| PMX1 \| PRX1	paired related homeobox 1	-	HPRD,BioGRID	9334314
PTP4A3	PRL-3 \| PRL-R \| PRL3	protein tyrosine phosphatase type IVA, member 3	Affinity Capture-MS	BioGRID	17353931
SRF	MCM1	serum response factor (c-fos serum response element-binding transcription factor)	-	HPRD,BioGRID	9334314
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD,BioGRID	9584171
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	9584171
USF1	FCHL \| FCHL1 \| HYPLIP1 \| MLTF \| MLTFI \| UEF \| bHLHb11	upstream transcription factor 1	-	HPRD,BioGRID	1961251 \|9384587\|9384587
YY1	DELTA \| INO80S \| NF-E1 \| UCRBP \| YIN-YANG-1	YY1 transcription factor	-	HPRD	11287625
ZBTB17	MIZ-1 \| ZNF151 \| ZNF60 \| pHZ-67	zinc finger and BTB domain containing 17	-	HPRD	12193603

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG BASAL TRANSCRIPTION FACTORS	36	24	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN	185	115	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN	165	107	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN	180	110	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN	181	107	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
SAKAI TUMOR INFILTRATING MONOCYTES DN	81	51	All SZGR 2.0 genes in this pathway
ADDYA ERYTHROID DIFFERENTIATION BY HEMIN	73	47	All SZGR 2.0 genes in this pathway
NEMETH INFLAMMATORY RESPONSE LPS DN	32	25	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN	86	67	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP	203	135	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
TOYOTA TARGETS OF MIR34B AND MIR34C	463	262	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN	193	112	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S2	115	74	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
DELPUECH FOXO3 TARGETS UP	68	49	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1103	1109	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-27	158	164	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	158	164	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-381	82	89	1A,m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GTF2I