SZGR2

Summary ?

GeneID	2977
Symbol	GUCY1A2
Synonyms	GC-SA2\|GUC1A2
Description	guanylate cyclase 1, soluble, alpha 2
Reference	MIM:601244\|HGNC:HGNC:4684\|Ensembl:ENSG00000152402\|HPRD:03146\|Vega:OTTHUMG00000166296
Gene type	protein-coding
Map location	11q21-q22
Pascal p-value	0.284
Fetal beta	0.618
eGene	Myers' cis & trans
Support	INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanPSD G2Cdb.humanPSP

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.006

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs12447283	chr16	65595638	GUCY1A2	2977		0.14		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004383	guanylate cyclase activity	TAS		1683630
GO:0020037	heme binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007242	intracellular signaling cascade	IEA		-
GO:0006182	cGMP biosynthetic process	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG PURINE METABOLISM	159	96	All SZGR 2.0 genes in this pathway
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION	115	81	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION	70	53	All SZGR 2.0 genes in this pathway
REACTOME NITRIC OXIDE STIMULATES GUANYLATE CYCLASE	25	19	All SZGR 2.0 genes in this pathway
REACTOME PLATELET HOMEOSTASIS	78	49	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN	178	121	All SZGR 2.0 genes in this pathway
CROONQUIST STROMAL STIMULATION UP	60	42	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-218	31	38	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GUCY1A2