SZGR2

Summary ?

GeneID	30818
Symbol	KCNIP3
Synonyms	CSEN\|DREAM\|KCHIP3
Description	potassium voltage-gated channel interacting protein 3
Reference	MIM:604662\|HGNC:HGNC:15523\|Ensembl:ENSG00000115041\|HPRD:05232\|Vega:OTTHUMG00000130392
Gene type	protein-coding
Map location	2q21.1
Pascal p-value	0.228
Sherlock p-value	0.795
Fetal beta	-1.997
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Cerebellum Frontal Cortex BA9 Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
GSMA_I	Genome scan meta-analysis	Psr: 0.0004
Expression	Meta-analysis of gene expression	P value: 1.492

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07166291	2	95971994	KCNIP3	2.854E-4	0.539	0.039	DMG:Wockner_2014
cg21350153	2	95982371	KCNIP3	2.864E-4	0.256	0.039	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs4654352	chr1	29789342	KCNIP3	30818		0.08		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
KIAA2013	0.81	0.81
RNH1	0.79	0.80
C3orf39	0.79	0.80
SCYL1	0.78	0.78
GRINA	0.77	0.77
LRRC14	0.77	0.75
DOHH	0.77	0.78
ZNF444	0.76	0.81
C11orf68	0.76	0.76
ATG4D	0.76	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.46	-0.38
NSBP1	-0.43	-0.44
AL139819.3	-0.43	-0.43
EIF5B	-0.41	-0.45
AC010300.1	-0.41	-0.48
AC090186.1	-0.41	-0.39
MT-ATP8	-0.41	-0.34
AC005921.3	-0.40	-0.44
FAM159B	-0.40	-0.57
SYCP3	-0.39	-0.43

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	TAS		10078534
GO:0003714	transcription corepressor activity	TAS		10078534
GO:0005509	calcium ion binding	IEA		-
GO:0005509	calcium ion binding	TAS		10900016
GO:0005244	voltage-gated ion channel activity	IEA		-
GO:0005267	potassium channel activity	IEA		-
GO:0005216	ion channel activity	IEA		-
GO:0030955	potassium ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		10078534
GO:0006350	transcription	IEA		-
GO:0007165	signal transduction	TAS		10900016
GO:0006811	ion transport	IEA		-
GO:0006813	potassium ion transport	IEA		-
GO:0006915	apoptosis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005783	endoplasmic reticulum	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA DREAM PATHWAY	14	13	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 LCP WITH H3K4ME3	162	80	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF LCP WITH H3K27ME3	70	35	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS LCP WITH H3K4ME3	174	100	All SZGR 2.0 genes in this pathway
MIKKELSEN ES LCP WITH H3K4ME3	142	80	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC LCP WITH H3K4ME3	58	34	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL PROGENITOR DN	14	9	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	1484	1491	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-125/351	1726	1733	1A,m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	1726	1733	1A,m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-218	1262	1269	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-218	1262	1269	1A,m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-409-3p	1253	1260	1A,m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: KCNIP3