Summary ?
GeneID30819
SymbolKCNIP2
SynonymsKCHIP2
Descriptionpotassium voltage-gated channel interacting protein 2
ReferenceMIM:604661|HGNC:HGNC:15522|Ensembl:ENSG00000120049|HPRD:06880|Vega:OTTHUMG00000018937
Gene typeprotein-coding
Map location10q24
Pascal p-value8.009E-5

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
MS4A6A0.690.79
CD1630.670.75
C3AR10.650.69
F13A10.640.73
FCER1G0.630.72
C1QA0.610.75
LYVE10.610.77
FGL20.600.68
RNASE60.600.65
ALOX5AP0.600.63
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
UPF3A-0.46-0.54
SH2B2-0.43-0.53
SH3BP2-0.42-0.53
AZI1-0.42-0.46
SAFB2-0.41-0.46
PABPN1-0.41-0.47
GLIS2-0.40-0.47
ZNF311-0.40-0.39
NINL-0.40-0.45
ANO8-0.40-0.43

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005509calcium ion bindingTAS11287421 
GO:0005244voltage-gated ion channel activityIEA-
GO:0005250A-type (transient outward) potassium channel activityTAS11287421 
GO:0005267potassium channel activityIEA-
GO:0005216ion channel activityIEA-
GO:0030955potassium ion bindingIEA-
GO:0046923ER retention sequence bindingNAS11287421 
GO:0047485protein N-terminus bindingIPI11287421 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0045163clustering of voltage-gated potassium channelsIDAneuron, axon (GO term level: 12)11287421 
GO:0007268synaptic transmissionNASneuron, Synap, Neurotransmitter (GO term level: 6)11287421 
GO:0005513detection of calcium ionTAS10676964 
GO:0007165signal transductionTAS10676964 
GO:0008016regulation of heart contractionTAS11287421 
GO:0006811ion transportIEA-
GO:0006813potassium ion transportTAS11287421 
GO:0006936muscle contractionNAS11287421 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIDA11287421 
GO:0005886plasma membraneIEA-
GO:0008076voltage-gated potassium channel complexNAS11287421 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION DN 184132All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS DN 6848All SZGR 2.0 genes in this pathway
KRISHNAN FURIN TARGETS DN 138All SZGR 2.0 genes in this pathway
MEISSNER ES ICP WITH H3K4ME3 3417All SZGR 2.0 genes in this pathway
MEISSNER BRAIN ICP WITH H3K4ME3 3217All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3 206108All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29337343m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-326110811151A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-33013011307m8hsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA