SZGR2

Summary ?

GeneID	3092
Symbol	HIP1
Synonyms	HIP-I\|ILWEQ\|SHON\|SHONbeta\|SHONgamma
Description	huntingtin interacting protein 1
Reference	MIM:601767\|HGNC:HGNC:4913\|Ensembl:ENSG00000127946\|HPRD:03461\|Vega:OTTHUMG00000156050
Gene type	protein-coding
Map location	7q11.23
Pascal p-value	0.291
Sherlock p-value	0.832
DEG p-value	DEG:Zhao_2015:p=1.55e-04:q=0.0745
Fetal beta	0.71
eGene	Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Zhao_2015	RNA Sequencing analysis	Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs869535	chr4	109331957	HIP1	3092		0.05		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030276	clathrin binding	IDA	Synap (GO term level: 4)	11577110
GO:0003779	actin binding	IEA		-
GO:0005543	phospholipid binding	IEA		-
GO:0005200	structural constituent of cytoskeleton	TAS		9140394
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006919	caspase activation	IDA		11788820
GO:0006897	endocytosis	IDA		11577110 \|11604514
GO:0042981	regulation of apoptosis	IDA		11788820
GO:0048268	clathrin coat assembly	IDA		11577110
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0012505	endomembrane system	IEA		-
GO:0005794	Golgi apparatus	IDA		11788820
GO:0005856	cytoskeleton	TAS		9147654
GO:0005624	membrane fraction	TAS		9147654
GO:0005737	cytoplasm	IDA		11604514
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AP2A1	ADTAA \| AP2-ALPHA \| CLAPA1	adaptor-related protein complex 2, alpha 1 subunit	-	HPRD	11517213 \|11532990\|11532990
AP2A1	ADTAA \| AP2-ALPHA \| CLAPA1	adaptor-related protein complex 2, alpha 1 subunit	-	HPRD,BioGRID	11532990
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	-	HPRD,BioGRID	11788820
CLTA	LCA	clathrin, light chain (Lca)	-	HPRD	11889126
CLTB	LCB	clathrin, light chain (Lcb)	-	HPRD	1189126
CLTC	CHC \| CHC17 \| CLH-17 \| CLTCL2 \| Hc \| KIAA0034	clathrin, heavy chain (Hc)	HIP1 interacts with Clathrin-HC (Clathrin heavy chain).	BIND	11517213
CLTC	CHC \| CHC17 \| CLH-17 \| CLTCL2 \| Hc \| KIAA0034	clathrin, heavy chain (Hc)	-	HPRD,BioGRID	11532990
EIF6	2 \| CAB \| EIF3A \| ITGB4BP \| b \| b(2)gcn \| gcn \| p27BBP	eukaryotic translation initiation factor 6	Two-hybrid	BioGRID	16169070
HIP1	ILWEQ \| MGC126506	huntingtin interacting protein 1	-	HPRD	11063258
HIP1	ILWEQ \| MGC126506	huntingtin interacting protein 1	HIP1 interacts with itself.	BIND	11063258
HIP1R	FLJ14000 \| FLJ27022 \| HIP12 \| HIP3 \| ILWEQ \| KIAA0655 \| MGC47513	huntingtin interacting protein 1 related	-	HPRD	11063258
HIP1R	FLJ14000 \| FLJ27022 \| HIP12 \| HIP3 \| ILWEQ \| KIAA0655 \| MGC47513	huntingtin interacting protein 1 related	-	HPRD,BioGRID	11063258 \|11889126
HIP1R	FLJ14000 \| FLJ27022 \| HIP12 \| HIP3 \| ILWEQ \| KIAA0655 \| MGC47513	huntingtin interacting protein 1 related	HIP1 interacts with HIP12.	BIND	11063258
HTT	HD \| IT15	huntingtin	-	HPRD,BioGRID	9147654 \|11063258
HTT	HD \| IT15	huntingtin	HIP1 interacts with HD.	BIND	11063258
IFT57	ESRRBL1 \| FLJ10147 \| HIPPI \| MHS4R2	intraflagellar transport 57 homolog (Chlamydomonas)	-	HPRD,BioGRID	11788820
PFDN1	PDF \| PFD1	prefoldin subunit 1	Two-hybrid	BioGRID	16169070
RPS10	MGC88819	ribosomal protein S10	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN	54	38	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS	148	97	All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME DN	17	9	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS UP	89	51	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G	171	96	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS DN	58	39	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
MATZUK SPERMATID DIFFERENTIATION	37	26	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G2	27	17	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	875	881	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	875	881	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	1787	1794	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	1787	1794	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-27	1788	1795	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1788	1795	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HIP1