Summary ?
GeneID31
SymbolACACA
SynonymsACAC|ACACAD|ACC|ACC1|ACCA
Descriptionacetyl-CoA carboxylase alpha
ReferenceMIM:200350|HGNC:HGNC:84|Ensembl:ENSG00000278540|HPRD:01938|Vega:OTTHUMG00000188463
Gene typeprotein-coding
Map location17q21
Pascal p-value0.074
Sherlock p-value0.359
DMG1 (# studies)
eGeneMeta
SupportG2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CNV:YESCopy number variation studiesManual curation
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0962 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg090362031735715797ACACA7.73E-9-0.033.76E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
DARS0.790.74
C11orf540.780.68
C6orf720.780.77
SCP20.760.72
DPY19L40.750.70
PNRC20.750.68
SEPT20.730.68
RHOA0.730.62
ZNF6800.720.67
PTCD30.720.65
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
AF347015.21-0.37-0.15
IL32-0.36-0.21
C10orf10-0.33-0.24
AL022328.1-0.33-0.23
IFI27-0.32-0.19
MT-CO2-0.32-0.18
ISG20-0.31-0.19
TMEM88-0.31-0.32
GZMM-0.30-0.26
CSAG1-0.30-0.20

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003989acetyl-CoA carboxylase activityTAS7905825 
GO:0004075biotin carboxylase activityIEA-
GO:0005515protein bindingIPI16326698 
GO:0005524ATP bindingIEA-
GO:0016874ligase activityIEA-
GO:0009374biotin bindingIEA-
GO:0030145manganese ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008152metabolic processIEA-
GO:0006633fatty acid biosynthetic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG PYRUVATE METABOLISM 4026All SZGR 2.0 genes in this pathway
KEGG PROPANOATE METABOLISM 3322All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY 137103All SZGR 2.0 genes in this pathway
BIOCARTA CHREBP2 PATHWAY 4235All SZGR 2.0 genes in this pathway
BIOCARTA LEPTIN PATHWAY 1111All SZGR 2.0 genes in this pathway
REACTOME TRIGLYCERIDE BIOSYNTHESIS 3826All SZGR 2.0 genes in this pathway
REACTOME FATTY ACYL COA BIOSYNTHESIS 1815All SZGR 2.0 genes in this pathway
REACTOME INTEGRATION OF ENERGY METABOLISM 12084All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS 478302All SZGR 2.0 genes in this pathway
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM 168115All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN 663425All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184125All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS UP 8140All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN 281186All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS DN 13976All SZGR 2.0 genes in this pathway
ODONNELL TARGETS OF MYC AND TFRC DN 4525All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316190All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 3 4WK UP 214144All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK DN 196131All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN 13797All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197135All SZGR 2.0 genes in this pathway
MIDORIKAWA AMPLIFIED IN LIVER CANCER 5538All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL 330217All SZGR 2.0 genes in this pathway
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER 14073All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747453All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK 10173All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON 13378All SZGR 2.0 genes in this pathway
SMITH LIVER CANCER 4527All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720440All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP 317208All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP 578341All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701446All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN 342220All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366257All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G3 UP 188121All SZGR 2.0 genes in this pathway
FOURNIER ACINAR DEVELOPMENT LATE 2 277172All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP 207143All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS LATE UP 10467All SZGR 2.0 genes in this pathway
STAMBOLSKY RESPONSE TO VITAMIN D3 UP 8448All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658397All SZGR 2.0 genes in this pathway
GUO TARGETS OF IRS1 AND IRS2 9867All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE 227151All SZGR 2.0 genes in this pathway
HORTON SREBF TARGETS 2520All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1150615121Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-200bc/429211217m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-378*465471m8hsa-miR-422bCUGGACUUGGAGUCAGAAGGCC
hsa-miR-422aCUGGACUUAGGGUCAGAAGGCC
miR-505229423001Ahsa-miR-505GUCAACACUUGCUGGUUUCCUC