Gene Page: MNX1
Summary ?
| GeneID | 3110 |
| Symbol | MNX1 |
| Synonyms | HB9|HLXB9|HOXHB9|SCRA1 |
| Description | motor neuron and pancreas homeobox 1 |
| Reference | MIM:142994|HGNC:HGNC:4979|Ensembl:ENSG00000130675|HPRD:00874|Vega:OTTHUMG00000157181 |
| Gene type | protein-coding |
| Map location | 7q36 |
| Pascal p-value | 0.634 |
| Fetal beta | 0.176 |
| DMG | 2 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07691705 | 7 | 156802325 | MNX1 | 2.57E-4 | -0.331 | 0.038 | DMG:Wockner_2014 |
| cg21182960 | 7 | 156812171 | MNX1 | 5.81E-8 | -0.016 | 1.48E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | NAS | - | |
| GO:0003702 | RNA polymerase II transcription factor activity | TAS | 7914194 | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030182 | neuron differentiation | IEA | neuron (GO term level: 8) | - |
| GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 9843207 | |
| GO:0009653 | anatomical structure morphogenesis | TAS | 9843207 | |
| GO:0006959 | humoral immune response | TAS | 7914194 | |
| GO:0021675 | nerve development | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG MATURITY ONSET DIABETES OF THE YOUNG | 25 | 19 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
| KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| SHIN B CELL LYMPHOMA CLUSTER 1 | 13 | 11 | All SZGR 2.0 genes in this pathway |
| STOSSI RESPONSE TO ESTRADIOL | 50 | 35 | All SZGR 2.0 genes in this pathway |
| ZHOU PANCREATIC EXOCRINE PROGENITOR | 11 | 10 | All SZGR 2.0 genes in this pathway |
| GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G1 S | 147 | 76 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-410 | 567 | 573 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-496 | 639 | 645 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.