Gene Page: DNAJA1
Summary ?
GeneID | 3301 |
Symbol | DNAJA1 |
Synonyms | DJ-2|DjA1|HDJ2|HSDJ|HSJ-2|HSJ2|HSPF4|NEDD7|hDJ-2 |
Description | DnaJ heat shock protein family (Hsp40) member A1 |
Reference | MIM:602837|HGNC:HGNC:5229|HPRD:04159| |
Gene type | protein-coding |
Map location | 9p13.3 |
Pascal p-value | 0.019 |
Sherlock p-value | 0.268 |
eGene | Myers' cis & trans |
Support | RNA AND PROTEIN SYNTHESIS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Expression | Meta-analysis of gene expression | P value: 2.107 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs13350793 | 0 | DNAJA1 | 3301 | 0.12 | trans | |||
rs10848708 | chr12 | 2931451 | DNAJA1 | 3301 | 0.03 | trans | ||
rs2286601 | chr12 | 2932176 | DNAJA1 | 3301 | 0.09 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NFYA | 0.95 | 0.90 |
FAM117B | 0.95 | 0.97 |
VANGL2 | 0.95 | 0.88 |
VASH2 | 0.95 | 0.91 |
MLLT4 | 0.95 | 0.95 |
KDM5B | 0.95 | 0.96 |
USP6NL | 0.94 | 0.96 |
AUTS2 | 0.94 | 0.93 |
SLCO5A1 | 0.94 | 0.91 |
EPHB1 | 0.94 | 0.84 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.64 | -0.82 |
SERPINB6 | -0.63 | -0.78 |
HLA-F | -0.63 | -0.84 |
LHPP | -0.63 | -0.65 |
TNFSF12 | -0.63 | -0.69 |
FBXO2 | -0.62 | -0.67 |
AIFM3 | -0.62 | -0.82 |
ALDOC | -0.62 | -0.76 |
HEPN1 | -0.62 | -0.82 |
PTH1R | -0.61 | -0.75 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008270 | zinc ion binding | IEA | - | |
GO:0031072 | heat shock protein binding | IEA | - | |
GO:0051082 | unfolded protein binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0050750 | low-density lipoprotein receptor binding | IDA | 15082773 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006457 | protein folding | IEA | - | |
GO:0006457 | protein folding | TAS | 8334160 | |
GO:0007283 | spermatogenesis | IEA | - | |
GO:0006986 | response to unfolded protein | TAS | 8334160 | |
GO:0030317 | sperm motility | IEA | - | |
GO:0030521 | androgen receptor signaling pathway | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ARL4D | ARF4L | ARL6 | ADP-ribosylation factor-like 4D | Two-hybrid | BioGRID | 16169070 |
CD58 | LFA-3 | LFA3 | CD58 molecule | Two-hybrid | BioGRID | 16169070 |
CFTR | ABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1 | cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) | - | HPRD,BioGRID | 10075921 |
HSPA8 | HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71 | heat shock 70kDa protein 8 | - | HPRD,BioGRID | 10075921 |
MAP3K7 | TAK1 | TGF1a | mitogen-activated protein kinase kinase kinase 7 | - | HPRD | 14743216 |
MAP3K7IP2 | FLJ21885 | KIAA0733 | TAB2 | mitogen-activated protein kinase kinase kinase 7 interacting protein 2 | - | HPRD | 14743216 |
OSGEP | FLJ20411 | GCPL1 | KAE1 | OSGEP1 | PRSMG1 | O-sialoglycoprotein endopeptidase | Affinity Capture-MS | BioGRID | 17353931 |
PTTG1 | EAP1 | HPTTG | MGC126883 | MGC138276 | PTTG | TUTR1 | pituitary tumor-transforming 1 | - | HPRD,BioGRID | 9915854 |
TH1L | HSPC130 | NELF-C | NELF-D | TH1 | TH1-like (Drosophila) | Two-hybrid | BioGRID | 16169070 |
TM4SF1 | H-L6 | L6 | M3S1 | TAAL6 | transmembrane 4 L six family member 1 | Two-hybrid | BioGRID | 16169070 |
TRADD | Hs.89862 | MGC11078 | TNFRSF1A-associated via death domain | - | HPRD | 14743216 |
UQCRC1 | D3S3191 | QCR1 | UQCR1 | ubiquinol-cytochrome c reductase core protein I | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID AR TF PATHWAY | 53 | 38 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS MAGENTA UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS UP | 67 | 40 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER PAX8 PPARG DN | 45 | 29 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
LUI TARGETS OF PAX8 PPARG FUSION | 34 | 23 | All SZGR 2.0 genes in this pathway |
AMUNDSON RESPONSE TO ARSENITE | 217 | 143 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE DN | 33 | 22 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
CAFFAREL RESPONSE TO THC DN | 31 | 23 | All SZGR 2.0 genes in this pathway |
CAFFAREL RESPONSE TO THC 8HR 5 DN | 11 | 8 | All SZGR 2.0 genes in this pathway |
SAKAI TUMOR INFILTRATING MONOCYTES DN | 81 | 51 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 DN | 169 | 102 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
SANA TNF SIGNALING UP | 83 | 56 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIC DAMAGE 24HR | 35 | 22 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
APRELIKOVA BRCA1 TARGETS | 49 | 33 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL UP | 120 | 89 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
ZHU CMV 8 HR UP | 47 | 39 | All SZGR 2.0 genes in this pathway |
KYNG RESPONSE TO H2O2 | 71 | 42 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
MATZUK MALE REPRODUCTION SERTOLI | 28 | 23 | All SZGR 2.0 genes in this pathway |
CHAUHAN RESPONSE TO METHOXYESTRADIOL UP | 51 | 32 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
WINNEPENNINCKX MELANOMA METASTASIS UP | 162 | 86 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
GUO TARGETS OF IRS1 AND IRS2 | 98 | 67 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-217 | 38 | 44 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.