SZGR2

Summary ?

GeneID	331
Symbol	XIAP
Synonyms	API3\|BIRC4\|IAP-3\|ILP1\|MIHA\|XLP2\|hIAP-3\|hIAP3
Description	X-linked inhibitor of apoptosis
Reference	MIM:300079\|HGNC:HGNC:592\|Ensembl:ENSG00000101966\|HPRD:02094\|Vega:OTTHUMG00000022336
Gene type	protein-coding
Map location	Xq25
Sherlock p-value	0.383
Fetal beta	0.192
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0781

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
snp_a-1882582		0	XIAP	331	0.13	trans
rs17115591	chr14	45262026	XIAP	331	0.13	trans
rs12917789	chr16	86029348	XIAP	331	0.19	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
APP	0.93	0.92
PRKAR1A	0.90	0.91
ATP2A2	0.89	0.91
RAB3GAP1	0.89	0.91
SYT11	0.89	0.86
AARS	0.89	0.89
NFE2L1	0.89	0.87
DCTN1	0.89	0.88
MAGEE1	0.88	0.88
M6PR	0.88	0.86

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.55	-0.35
C1orf54	-0.52	-0.41
C1orf61	-0.51	-0.49
FAM159B	-0.48	-0.49
GNG11	-0.47	-0.34
AL050337.1	-0.47	-0.35
AP002478.3	-0.46	-0.40
AC098691.2	-0.46	-0.38
IL32	-0.45	-0.32
SYCP3	-0.45	-0.37

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004869	cysteine protease inhibitor activity	IEA		-
GO:0005515	protein binding	IPI		11801603 \|16282325 \|16887178
GO:0016874	ligase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0043027	caspase inhibitor activity	IDA		9230442
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006511	ubiquitin-dependent protein catabolic process	IEA		-
GO:0006916	anti-apoptosis	TAS		8654366
GO:0043154	negative regulation of caspase activity	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	EXP		11257231
GO:0005829	cytosol	TAS		8654366
GO:0005622	intracellular	IEA		-
GO:0005737	cytoplasm	TAS		8654366

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACVR1B	ACTRIB \| ACVRLK4 \| ALK4 \| SKR2	activin A receptor, type IB	An unspecified isoform of ALK4 interacts with XIAP. This interaction was modeled on a demonstrated interaction between ALK4 from an unspecified species and human XIAP.	BIND	11356828
ACVRL1	ACVRLK1 \| ALK-1 \| ALK1 \| HHT \| HHT2 \| ORW2 \| SKR3 \| TSR-I	activin A receptor type II-like 1	ALK1 interacts with XIAP. This interaction was modeled on a demonstrated interaction between ALK1 from an unspecified species and human XIAP.	BIND	11356828
CASP2	CASP-2 \| ICH-1L \| ICH-1L/1S \| ICH1 \| NEDD2	caspase 2, apoptosis-related cysteine peptidase	Phenotypic Suppression	BioGRID	11832478
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	-	HPRD	9230442 \|11447297 \|11927604
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	XIAP interacts with Casp-3.	BIND	15200957
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	Affinity Capture-Western Co-crystal Structure in vitro in vivo Reconstituted Complex	BioGRID	9230442 \|9384571 \|11257232 \|11447297 \|11927604
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	Caspase-3 interacts with XIAP.	BIND	15650747
CASP4	ICE(rel)II \| ICEREL-II \| ICH-2 \| Mih1/TX \| TX	caspase 4, apoptosis-related cysteine peptidase	Affinity Capture-Western	BioGRID	11927604
CASP6	MCH2	caspase 6, apoptosis-related cysteine peptidase	XIAP interacts with Casp-6.	BIND	15200957
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	XIAP interacts with caspase-7.	BIND	15580265
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	-	HPRD	9230442 \|11359776
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	Caspase-7 interacts with XIAP.	BIND	15650747
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	in vitro in vivo Reconstituted Complex	BioGRID	9230442 \|9384571 \|11257232 \|11359776
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	XIAP interacts with Casp-7.	BIND	15200957
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	Phenotypic Suppression	BioGRID	11832478
CASP9	APAF-3 \| APAF3 \| CASPASE-9c \| ICE-LAP6 \| MCH6	caspase 9, apoptosis-related cysteine peptidase	XIAP interacts with and ubiquitinates Caspase-9.	BIND	15300255
CASP9	APAF-3 \| APAF3 \| CASPASE-9c \| ICE-LAP6 \| MCH6	caspase 9, apoptosis-related cysteine peptidase	Affinity Capture-Western Far Western Reconstituted Complex Two-hybrid	BioGRID	9545235 \|11390657 \|15280366 \|16189514
CASP9	APAF-3 \| APAF3 \| CASPASE-9c \| ICE-LAP6 \| MCH6	caspase 9, apoptosis-related cysteine peptidase	-	HPRD	9545235 \|11927604
CHEK1	CHK1	CHK1 checkpoint homolog (S. pombe)	Reconstituted Complex	BioGRID	14759516
COMMD1	C2orf5 \| MGC27155 \| MURR1	copper metabolism (Murr1) domain containing 1	-	HPRD	14685242
DIABLO	DIABLO-S \| FLJ10537 \| FLJ25049 \| SMAC \| SMAC3	diablo homolog (Drosophila)	Smac interacts with XIAP.	BIND	15650747
DIABLO	DIABLO-S \| FLJ10537 \| FLJ25049 \| SMAC \| SMAC3	diablo homolog (Drosophila)	XIAP interacts with and ubiquitinates SMAC.	BIND	15300255
DIABLO	DIABLO-S \| FLJ10537 \| FLJ25049 \| SMAC \| SMAC3	diablo homolog (Drosophila)	-	HPRD,BioGRID	10929712
DYNLL2	DNCL1B \| Dlc2 \| MGC17810	dynein, light chain, LC8-type 2	Two-hybrid	BioGRID	16189514
GSPT1	551G9.2 \| ETF3A \| FLJ38048 \| FLJ39067 \| GST1 \| eRF3a	G1 to S phase transition 1	-	HPRD,BioGRID	12865429
HTRA2	OMI \| PARK13 \| PRSS25	HtrA serine peptidase 2	-	HPRD,BioGRID	11604410
HTRA2	OMI \| PARK13 \| PRSS25	HtrA serine peptidase 2	XIAP interacts with HtrA2.	BIND	15300255
MAGED1	DLXIN-1 \| NRAGE	melanoma antigen family D, 1	-	HPRD,BioGRID	11546791
MAP3K7	TAK1 \| TGF1a	mitogen-activated protein kinase kinase kinase 7	-	HPRD,BioGRID	12048196
MAP3K7IP1	3'-Tab1 \| MGC57664 \| TAB1	mitogen-activated protein kinase kinase kinase 7 interacting protein 1	-	HPRD,BioGRID	9878061
MAP3K7IP1	3'-Tab1 \| MGC57664 \| TAB1	mitogen-activated protein kinase kinase kinase 7 interacting protein 1	XIAP interacts with TAB1.	BIND	9878061
MAP3K7IP2	FLJ21885 \| KIAA0733 \| TAB2	mitogen-activated protein kinase kinase kinase 7 interacting protein 2	-	HPRD,BioGRID	12048196
STRADB	ALS2CR2 \| CALS-21 \| ILPIP \| ILPIPA \| MGC102916 \| PAPK \| PRO1038	STE20-related kinase adaptor beta	-	HPRD,BioGRID	12048196
TGFBR1	AAT5 \| ACVRLK4 \| ALK-5 \| ALK5 \| LDS1A \| LDS2A \| SKR4 \| TGFR-1	transforming growth factor, beta receptor 1	TGF-beta-RI interacts with XIAP. This interaction was modeled on a demonstrated interaction between TGF-beta-RI from an unspecified species and human XIAP.	BIND	11356828
TRAF6	MGC:3310 \| RNF85	TNF receptor-associated factor 6	-	HPRD,BioGRID	12048196
WDYHV1	C8orf32 \| FLJ10204	WDYHV motif containing 1	Two-hybrid	BioGRID	16189514
XAF1	BIRC4BP \| HSXIAPAF1 \| XIAPAF1	XIAP associated factor 1	-	HPRD,BioGRID	11175744
XIAP	API3 \| BIRC4 \| ILP1 \| MIHA \| XLP2	X-linked inhibitor of apoptosis	Two-hybrid	BioGRID	16189514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG UBIQUITIN MEDIATED PROTEOLYSIS	138	98	All SZGR 2.0 genes in this pathway
KEGG APOPTOSIS	88	62	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG NOD LIKE RECEPTOR SIGNALING PATHWAY	62	47	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG SMALL CELL LUNG CANCER	84	67	All SZGR 2.0 genes in this pathway
BIOCARTA BCELLSURVIVAL PATHWAY	16	10	All SZGR 2.0 genes in this pathway
BIOCARTA CASPASE PATHWAY	23	15	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA DEATH PATHWAY	33	24	All SZGR 2.0 genes in this pathway
BIOCARTA MITOCHONDRIA PATHWAY	21	15	All SZGR 2.0 genes in this pathway
SA CASPASE CASCADE	19	13	All SZGR 2.0 genes in this pathway
ST FAS SIGNALING PATHWAY	65	54	All SZGR 2.0 genes in this pathway
PID P75 NTR PATHWAY	69	51	All SZGR 2.0 genes in this pathway
PID BMP PATHWAY	42	31	All SZGR 2.0 genes in this pathway
PID CASPASE PATHWAY	52	39	All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY	55	38	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME INTRINSIC PATHWAY FOR APOPTOSIS	30	21	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN	352	225	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
MARKS HDAC TARGETS DN	15	11	All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP	207	128	All SZGR 2.0 genes in this pathway
DUTTA APOPTOSIS VIA NFKB	33	25	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
KUROKAWA LIVER CANCER CHEMOTHERAPY DN	41	28	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE	35	28	All SZGR 2.0 genes in this pathway
SU SALIVARY GLAND	16	9	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN	86	66	All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1	419	273	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
LEE RECENT THYMIC EMIGRANT	227	128	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS UP	143	100	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN	207	139	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-122	2640	2646	1A	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-17-5p/20/93.mr/106/519.d	1228	1234	1A	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-186	6778	6785	1A,m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-200bc/429	1255	1261	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-23	1017	1024	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
				hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
				hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-27	6748	6754	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	6748	6754	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-323	3114	3121	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-323	3114	3121	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-330	1049	1055	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-34b	1218	1224	1A	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-494	1112	1118	1A	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-495	1245	1251	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-7	1168	1174	1A	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-96	1012	1018	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: XIAP