Gene Page: HSPB1
Summary ?
GeneID | 3315 |
Symbol | HSPB1 |
Synonyms | CMT2F|HEL-S-102|HMN2B|HS.76067|HSP27|HSP28|Hsp25|SRP27 |
Description | heat shock protein family B (small) member 1 |
Reference | MIM:602195|HGNC:HGNC:5246|Ensembl:ENSG00000106211|HPRD:09076|Vega:OTTHUMG00000023228 |
Gene type | protein-coding |
Map location | 7q11.23 |
Pascal p-value | 0.17 |
Sherlock p-value | 0.763 |
Fetal beta | -0.113 |
eGene | Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0143 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7607798 | chr2 | 102043108 | HSPB1 | 3315 | 0.07 | trans | ||
rs11722940 | chr4 | 120233215 | HSPB1 | 3315 | 0.19 | trans | ||
rs17595790 | chr4 | 120276219 | HSPB1 | 3315 | 0.15 | trans | ||
rs2700772 | chr8 | 5837584 | HSPB1 | 3315 | 0.08 | trans | ||
rs2700770 | chr8 | 5837808 | HSPB1 | 3315 | 0.08 | trans | ||
rs2247957 | chr8 | 5845867 | HSPB1 | 3315 | 0.18 | trans | ||
rs10842557 | 0 | HSPB1 | 3315 | 0.03 | trans | |||
rs7215675 | chr17 | 10905819 | HSPB1 | 3315 | 0.08 | trans | ||
rs16944595 | chr17 | 11242834 | HSPB1 | 3315 | 0.13 | trans | ||
rs2073206 | chr20 | 948279 | HSPB1 | 3315 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0042802 | identical protein binding | IPI | 11003656 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006446 | regulation of translational initiation | TAS | 10859165 | |
GO:0006986 | response to unfolded protein | TAS | 10859165 | |
GO:0006928 | cell motion | TAS | 16130169 | |
GO:0006916 | anti-apoptosis | TAS | 16130169 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | TAS | 16130169 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | TAS | 16130169 | |
GO:0009986 | cell surface | IDA | 12493773 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | Affinity Capture-Western | BioGRID | 11042204 |
C1orf103 | FLJ11269 | RIF1 | RP11-96K19.1 | chromosome 1 open reading frame 103 | Two-hybrid | BioGRID | 16169070 |
C7orf64 | DKFZP564O0523 | DKFZp686D1651 | HSPC304 | chromosome 7 open reading frame 64 | Two-hybrid | BioGRID | 16169070 |
CRYAA | CRYA1 | HSPB4 | crystallin, alpha A | - | HPRD,BioGRID | 11700327 |
CRYAB | CRYA2 | CTPP2 | HSPB5 | crystallin, alpha B | - | HPRD,BioGRID | 1560006 |11700327 |
CRYBB2 | CCA2 | CRYB2 | CRYB2A | D22S665 | crystallin, beta B2 | - | HPRD,BioGRID | 11700327 |
CRYGC | CCL | CRYG3 | crystallin, gamma C | - | HPRD | 11700327 |
CYCS | CYC | HCS | cytochrome c, somatic | Affinity Capture-Western | BioGRID | 11784858 |
EIF4G1 | DKFZp686A1451 | EIF4F | EIF4G | p220 | eukaryotic translation initiation factor 4 gamma, 1 | - | HPRD | 10859165 |
HSPB8 | CMT2L | DHMN2 | E2IG1 | H11 | HMN2 | HMN2A | HSP22 | heat shock 22kDa protein 8 | - | HPRD,BioGRID | 11342557 |14594798 |15122253 |
HSPB8 | CMT2L | DHMN2 | E2IG1 | H11 | HMN2 | HMN2A | HSP22 | heat shock 22kDa protein 8 | HSP22 interacts with HSP27. | BIND | 14594798 |
IGSF21 | FLJ41177 | MGC15730 | immunoglobin superfamily, member 21 | Two-hybrid | BioGRID | 16169070 |
ILK | DKFZp686F1765 | P59 | integrin-linked kinase | Affinity Capture-MS | BioGRID | 17353931 |
MAGED1 | DLXIN-1 | NRAGE | melanoma antigen family D, 1 | Affinity Capture-MS | BioGRID | 17353931 |
MAPKAPK2 | MK2 | mitogen-activated protein kinase-activated protein kinase 2 | - | HPRD,BioGRID | 11042204 |
MAPKAPK2 | MK2 | mitogen-activated protein kinase-activated protein kinase 2 | MK2 phosphorylates Hsp27. This interaction was modelled on a demonstrated interaction between human MK2 and Hsp27 from an unspecified species. | BIND | 15692053 |
MAPKAPK5 | PRAK | mitogen-activated protein kinase-activated protein kinase 5 | - | HPRD,BioGRID | 9628874 |
MED31 | 3110004H13Rik | CGI-125 | FLJ27436 | FLJ36714 | Soh1 | mediator complex subunit 31 | Two-hybrid | BioGRID | 16169070 |
POP7 | 0610037N12Rik | RPP2 | RPP20 | processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) | Rpp20 interacts with Hsp27 | BIND | 11158571 |
PPA1 | IOPPP | MGC111556 | PP | PP1 | SID6-8061 | pyrophosphatase (inorganic) 1 | Two-hybrid | BioGRID | 16169070 |
TGFB1I1 | ARA55 | HIC-5 | HIC5 | TSC-5 | transforming growth factor beta 1 induced transcript 1 | Two-hybrid | BioGRID | 11546764 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG VEGF SIGNALING PATHWAY | 76 | 53 | All SZGR 2.0 genes in this pathway |
BIOCARTA MTA3 PATHWAY | 19 | 10 | All SZGR 2.0 genes in this pathway |
BIOCARTA P38MAPK PATHWAY | 40 | 31 | All SZGR 2.0 genes in this pathway |
BIOCARTA HSP27 PATHWAY | 15 | 11 | All SZGR 2.0 genes in this pathway |
ST P38 MAPK PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
ST FAS SIGNALING PATHWAY | 65 | 54 | All SZGR 2.0 genes in this pathway |
PID P38 MK2 PATHWAY | 21 | 19 | All SZGR 2.0 genes in this pathway |
PID P38 ALPHA BETA DOWNSTREAM PATHWAY | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF MRNA STABILITY BY PROTEINS THAT BIND AU RICH ELEMENTS | 84 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME DESTABILIZATION OF MRNA BY AUF1 HNRNP D0 | 53 | 31 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
TIMOFEEVA GROWTH STRESS VIA STAT1 DN | 16 | 12 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION UP | 119 | 66 | All SZGR 2.0 genes in this pathway |
HOEBEKE LYMPHOID STEM CELL DN | 86 | 59 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION SUSTAINED IN GRANULOCYTE UP | 15 | 9 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION GRANULOCYTE UP | 55 | 34 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP | 204 | 140 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP | 157 | 104 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION SUSTAINED IN MONOCYTE UP | 21 | 15 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION SUSTAINDED IN ERYTHROCYTE UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE DN | 43 | 29 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP | 117 | 84 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
STREICHER LSM1 TARGETS UP | 44 | 34 | All SZGR 2.0 genes in this pathway |
PEREZ TP63 TARGETS | 355 | 243 | All SZGR 2.0 genes in this pathway |
LI LUNG CANCER | 41 | 30 | All SZGR 2.0 genes in this pathway |
LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
AIYAR COBRA1 TARGETS DN | 29 | 18 | All SZGR 2.0 genes in this pathway |
STANHILL HRAS TRANSFROMATION UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC UP | 14 | 7 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
ZHANG PROLIFERATING VS QUIESCENT | 51 | 41 | All SZGR 2.0 genes in this pathway |
DELLA RESPONSE TO TSA AND BUTYRATE | 21 | 17 | All SZGR 2.0 genes in this pathway |
GEORGANTAS HSC MARKERS | 71 | 47 | All SZGR 2.0 genes in this pathway |
ZHOU TNF SIGNALING 30MIN | 54 | 36 | All SZGR 2.0 genes in this pathway |
JACKSON DNMT1 TARGETS UP | 77 | 57 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
ZAMORA NOS2 TARGETS DN | 96 | 71 | All SZGR 2.0 genes in this pathway |
LEE AGING MUSCLE UP | 45 | 33 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
HANN RESISTANCE TO BCL2 INHIBITOR DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS UP | 198 | 128 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D UP | 89 | 62 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE | 101 | 76 | All SZGR 2.0 genes in this pathway |
SHAFFER IRF4 TARGETS IN PLASMA CELL VS MATURE B LYMPHOCYTE | 67 | 51 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 15 | 31 | 19 | All SZGR 2.0 genes in this pathway |
VALK AML WITH CEBPA | 37 | 27 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
KESHELAVA MULTIPLE DRUG RESISTANCE | 88 | 56 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
MIKHAYLOVA OXIDATIVE STRESS RESPONSE VIA VHL DN | 6 | 5 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
CHEMELLO SOLEUS VS EDL MYOFIBERS UP | 35 | 16 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-539 | 91 | 97 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.