Gene Page: DNAJB1
Summary ?
| GeneID | 3337 |
| Symbol | DNAJB1 |
| Synonyms | HSPF1|Hdj1|Hsp40|RSPH16B|Sis1 |
| Description | DnaJ heat shock protein family (Hsp40) member B1 |
| Reference | MIM:604572|HGNC:HGNC:5270|Ensembl:ENSG00000132002|HPRD:05198|Vega:OTTHUMG00000183289 |
| Gene type | protein-coding |
| Map location | 19p13.2 |
| Pascal p-value | 0.005 |
| Sherlock p-value | 0.796 |
| Fetal beta | 0.242 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg01083584 | 19 | 14629193 | DNAJB1 | 3.956E-4 | -0.209 | 0.043 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7593761 | chr2 | 197275602 | DNAJB1 | 3337 | 0.01 | trans | ||
| rs12641054 | chr4 | 113071694 | DNAJB1 | 3337 | 0.1 | trans | ||
| rs10868543 | chr9 | 89852686 | DNAJB1 | 3337 | 0.01 | trans | ||
| rs906309 | chr15 | 98304785 | DNAJB1 | 3337 | 0.12 | trans | ||
| rs9920555 | chr15 | 98417871 | DNAJB1 | 3337 | 0.15 | trans | ||
| rs10492782 | chr16 | 13210707 | DNAJB1 | 3337 | 0.01 | trans | ||
| rs7215675 | chr17 | 10905819 | DNAJB1 | 3337 | 0.09 | trans | ||
| rs16944595 | chr17 | 11242834 | DNAJB1 | 3337 | 0.03 | trans | ||
| rs8120542 | chr20 | 24395092 | DNAJB1 | 3337 | 0.18 | trans | ||
| rs8114637 | chr20 | 24395207 | DNAJB1 | 3337 | 0.18 | trans | ||
| rs9974024 | chr20 | 24397274 | DNAJB1 | 3337 | 0.18 | trans | ||
| rs6515493 | chr20 | 24401635 | DNAJB1 | 3337 | 0.18 | trans | ||
| rs6049703 | chr20 | 24432425 | DNAJB1 | 3337 | 0 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NLGN1 | 0.77 | 0.52 |
| TIAM2 | 0.77 | 0.52 |
| SEMA3A | 0.75 | 0.52 |
| LIMCH1 | 0.75 | 0.54 |
| TGFBR1 | 0.75 | 0.55 |
| AL590362.2 | 0.75 | 0.49 |
| SORCS1 | 0.74 | 0.46 |
| EML1 | 0.74 | 0.59 |
| KCTD12 | 0.73 | 0.51 |
| FAM59A | 0.73 | 0.58 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TNFSF12 | -0.43 | -0.43 |
| SERPINB6 | -0.43 | -0.40 |
| PTH1R | -0.40 | -0.45 |
| AC007405.8 | -0.40 | -0.43 |
| SLC9A3R2 | -0.40 | -0.36 |
| SLC16A11 | -0.40 | -0.42 |
| TMEM54 | -0.40 | -0.39 |
| TSC22D4 | -0.40 | -0.48 |
| C5orf53 | -0.40 | -0.45 |
| HSD17B14 | -0.40 | -0.45 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0031072 | heat shock protein binding | IEA | - | |
| GO:0051082 | unfolded protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006457 | protein folding | IEA | - | |
| GO:0006986 | response to unfolded protein | TAS | 8975727 | |
| GO:0051085 | chaperone cofactor-dependent protein folding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP | 136 | 80 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
| NAGASHIMA EGF SIGNALING UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
| YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 DN | 87 | 48 | All SZGR 2.0 genes in this pathway |
| WOOD EBV EBNA1 TARGETS UP | 110 | 71 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA FRA2 TARGETS | 43 | 27 | All SZGR 2.0 genes in this pathway |
| CAFFAREL RESPONSE TO THC 8HR 5 DN | 11 | 8 | All SZGR 2.0 genes in this pathway |
| SUH COEXPRESSED WITH ID1 AND ID2 UP | 19 | 14 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| MORI SMALL PRE BII LYMPHOCYTE DN | 76 | 52 | All SZGR 2.0 genes in this pathway |
| UEDA CENTRAL CLOCK | 88 | 62 | All SZGR 2.0 genes in this pathway |
| MENSSEN MYC TARGETS | 53 | 35 | All SZGR 2.0 genes in this pathway |
| PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
| LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
| GERY CEBP TARGETS | 126 | 90 | All SZGR 2.0 genes in this pathway |
| GENTILE UV RESPONSE CLUSTER D9 | 28 | 15 | All SZGR 2.0 genes in this pathway |
| ZAMORA NOS2 TARGETS UP | 69 | 41 | All SZGR 2.0 genes in this pathway |
| MARCHINI TRABECTEDIN RESISTANCE UP | 21 | 16 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
| CHIBA RESPONSE TO TSA | 50 | 31 | All SZGR 2.0 genes in this pathway |
| GERHOLD ADIPOGENESIS DN | 64 | 44 | All SZGR 2.0 genes in this pathway |
| TAKAO RESPONSE TO UVB RADIATION DN | 98 | 67 | All SZGR 2.0 genes in this pathway |
| ZHENG RESPONSE TO ARSENITE UP | 18 | 14 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS PEAK AT 2HR | 51 | 36 | All SZGR 2.0 genes in this pathway |
| MCCLUNG COCAIN REWARD 4WK | 75 | 47 | All SZGR 2.0 genes in this pathway |
| KYNG RESPONSE TO H2O2 VIA ERCC6 | 17 | 9 | All SZGR 2.0 genes in this pathway |
| VISALA RESPONSE TO HEAT SHOCK AND AGING DN | 14 | 12 | All SZGR 2.0 genes in this pathway |
| KYNG RESPONSE TO H2O2 | 71 | 42 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| HELLER SILENCED BY METHYLATION DN | 105 | 67 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER GOOD SURVIVAL A5 | 70 | 32 | All SZGR 2.0 genes in this pathway |
| KYNG RESPONSE TO H2O2 VIA ERCC6 DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G2 | 182 | 102 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-137 | 552 | 559 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-143 | 497 | 503 | 1A | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
| miR-155 | 1145 | 1152 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-19 | 831 | 838 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-543 | 121 | 127 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| miR-9 | 1112 | 1118 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.