Summary ?
GeneID339745
SymbolSPOPL
SynonymsBTBD33
Descriptionspeckle type BTB/POZ protein like
ReferenceHGNC:HGNC:27934|Ensembl:ENSG00000144228|HPRD:11261|Vega:OTTHUMG00000153635
Gene typeprotein-coding
Map location2q22.1
Pascal p-value0.002
Fetal beta0.204
DMG1 (# studies)
eGeneFrontal Cortex BA9

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:GWAScatGenome-wide Association StudiesThis data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.02395 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg052849272139259034SPOPL2.06E-8-0.0097.09E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP 450256All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS UP 8140All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP 7950All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457269All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238144All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278748All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375806All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE DN 230115All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP 176115All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292168All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544307All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS UNANNOTATED DN 193112All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D 280158All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839928All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.12052111Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506264270m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-12823602366m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-130/3012973041A,m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-17-5p/20/93.mr/106/519.d36113617m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-183282328301A,m8hsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-2173133201A,m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-218280728131Ahsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-2331303136m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-3201711781A,m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-323313031361Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-38437593765m8hsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-433-3p323532411Ahsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-73563621Ahsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG