Summary ?
GeneID347730
SymbolLRRTM1
Synonyms-
Descriptionleucine rich repeat transmembrane neuronal 1
ReferenceMIM:610867|HGNC:HGNC:19408|Ensembl:ENSG00000162951|HPRD:14323|Vega:OTTHUMG00000130021
Gene typeprotein-coding
Map location2p12
Pascal p-value0.202
Fetal beta0.982
eGeneMyers' cis & trans
SupportG2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.0004 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizotypy,schizophrenias,schizotypalClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs4975794chr52015329LRRTM13477300.09trans
rs2286499chr722857476LRRTM13477300.08trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030426growth coneIDAaxon, dendrite (GO term level: 5)17667961 
GO:0030424axonIDAneuron, axon, Neurotransmitter (GO term level: 6)17667961 
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005783endoplasmic reticulumIDA17667961 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0009986cell surfaceIDA17667961 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PEREZ TP53 TARGETS 1174695All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038678All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062725All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652441All SZGR 2.0 genes in this pathway
CHENG IMPRINTED BY ESTRADIOL 11068All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2081641701Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-30-3p111117m8hsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-3201531591Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-3261341411A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-3782822881Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-4991641701Ahsa-miR-499UUAAGACUUGCAGUGAUGUUUAA