Gene Page: IL2
Summary ?
GeneID | 3558 |
Symbol | IL2 |
Synonyms | IL-2|TCGF|lymphokine |
Description | interleukin 2 |
Reference | MIM:147680|HGNC:HGNC:6001|HPRD:00979| |
Gene type | protein-coding |
Map location | 4q26-q27 |
Pascal p-value | 0.083 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005134 | interleukin-2 receptor binding | TAS | 8476561 | |
GO:0005125 | cytokine activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0019209 | kinase activator activity | TAS | 8476561 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030101 | natural killer cell activation | TAS | 8476561 | |
GO:0007267 | cell-cell signaling | TAS | 8476561 | |
GO:0048304 | positive regulation of isotype switching to IgG isotypes | IEA | - | |
GO:0008284 | positive regulation of cell proliferation | TAS | 8476561 | |
GO:0006955 | immune response | TAS | 8476561 | |
GO:0006916 | anti-apoptosis | TAS | 8476561 | |
GO:0042523 | positive regulation of tyrosine phosphorylation of Stat5 protein | IEA | - | |
GO:0051024 | positive regulation of immunoglobulin secretion | IEA | - | |
GO:0042104 | positive regulation of activated T cell proliferation | IEA | - | |
GO:0030217 | T cell differentiation | TAS | 8476561 | |
GO:0030307 | positive regulation of cell growth | TAS | 8476561 | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0050672 | negative regulation of lymphocyte proliferation | IEA | - | |
GO:0050728 | negative regulation of inflammatory response | IEA | - | |
GO:0046013 | regulation of T cell homeostatic proliferation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | TAS | 8476561 | |
GO:0005615 | extracellular space | IEA | - |
Section V. Pathway annotation
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-186 | 145 | 151 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.