Gene Page: ILK
Summary ?
GeneID | 3611 |
Symbol | ILK |
Synonyms | HEL-S-28|ILK-1|ILK-2|P59|p59ILK |
Description | integrin linked kinase |
Reference | MIM:602366|HGNC:HGNC:6040|Ensembl:ENSG00000166333|HPRD:03842|Vega:OTTHUMG00000133407 |
Gene type | protein-coding |
Map location | 11p15.4 |
Pascal p-value | 0.014 |
Sherlock p-value | 0.298 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.2113 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NOTCH3 | 0.86 | 0.84 |
LRIG1 | 0.84 | 0.86 |
BMP7 | 0.81 | 0.82 |
ASAP3 | 0.80 | 0.77 |
SYDE1 | 0.79 | 0.80 |
LAMB2 | 0.79 | 0.85 |
NRARP | 0.79 | 0.75 |
CTDSP1 | 0.79 | 0.79 |
LTBP3 | 0.78 | 0.79 |
ZFP36L2 | 0.77 | 0.79 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NDUFAF2 | -0.46 | -0.58 |
VPS29 | -0.45 | -0.52 |
PFDN4 | -0.45 | -0.60 |
C20orf7 | -0.44 | -0.52 |
PSMA6 | -0.43 | -0.57 |
GPR22 | -0.42 | -0.45 |
MRPL1 | -0.41 | -0.52 |
PPP2R3C | -0.41 | -0.54 |
FAM92A1 | -0.41 | -0.50 |
TAF9 | -0.41 | -0.50 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IPI | 16936772 |17353931 |18339839 | |
GO:0005524 | ATP binding | NAS | - | |
GO:0004674 | protein serine/threonine kinase activity | IDA | 10871859 | |
GO:0004713 | protein tyrosine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0016301 | kinase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001658 | ureteric bud branching | IEA | - | |
GO:0007160 | cell-matrix adhesion | NAS | - | |
GO:0006468 | protein amino acid phosphorylation | IDA | 10871859 | |
GO:0007229 | integrin-mediated signaling pathway | IEA | - | |
GO:0007229 | integrin-mediated signaling pathway | NAS | - | |
GO:0008284 | positive regulation of cell proliferation | IEA | - | |
GO:0045197 | establishment or maintenance of epithelial cell apical/basal polarity | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | NAS | - | |
GO:0005925 | focal adhesion | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ACP6 | ACPL1 | LPAP | PACPL1 | acid phosphatase 6, lysophosphatidic | Affinity Capture-MS | BioGRID | 17353931 |
AKT1 | AKT | MGC99656 | PKB | PKB-ALPHA | PRKBA | RAC | RAC-ALPHA | v-akt murine thymoma viral oncogene homolog 1 | - | HPRD,BioGRID | 9736715 |
AUP1 | - | ancient ubiquitous protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
CAV1 | CAV | MSTP085 | VIP21 | caveolin 1, caveolae protein, 22kDa | ILK1 interacts with caveolin-1. | BIND | 15722199 |
COPB2 | beta'-COP | coatomer protein complex, subunit beta 2 (beta prime) | Affinity Capture-MS | BioGRID | 17353931 |
COPG | COPG1 | FLJ21068 | coatomer protein complex, subunit gamma | Affinity Capture-MS | BioGRID | 17353931 |
DDX3X | DBX | DDX14 | DDX3 | HLP2 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked | Affinity Capture-MS | BioGRID | 17353931 |
DHX36 | DDX36 | G4R1 | KIAA1488 | MLEL1 | RHAU | DEAH (Asp-Glu-Ala-His) box polypeptide 36 | Affinity Capture-MS | BioGRID | 17353931 |
ERH | DROER | FLJ27340 | enhancer of rudimentary homolog (Drosophila) | Affinity Capture-MS | BioGRID | 17353931 |
EWSR1 | EWS | Ewing sarcoma breakpoint region 1 | Affinity Capture-MS | BioGRID | 17353931 |
FANCI | FLJ10719 | KIAA1794 | Fanconi anemia, complementation group I | Affinity Capture-MS | BioGRID | 17353931 |
GEMIN4 | DKFZp434B131 | DKFZp434D174 | HC56 | HCAP1 | HHRF-1 | p97 | gem (nuclear organelle) associated protein 4 | Affinity Capture-MS | BioGRID | 17353931 |
GSK3B | - | glycogen synthase kinase 3 beta | - | HPRD | 9736715 |
HEATR1 | BAP28 | FLJ10359 | MGC72083 | HEAT repeat containing 1 | Affinity Capture-MS | BioGRID | 17353931 |
HEATR2 | FLJ20397 | FLJ25564 | FLJ31671 | FLJ39381 | HEAT repeat containing 2 | Affinity Capture-MS | BioGRID | 17353931 |
HSPB1 | CMT2F | DKFZp586P1322 | HMN2B | HS.76067 | HSP27 | HSP28 | Hsp25 | SRP27 | heat shock 27kDa protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
IGF2BP1 | CRD-BP | CRDBP | IMP-1 | IMP1 | VICKZ1 | ZBP1 | insulin-like growth factor 2 mRNA binding protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
ILK | DKFZp686F1765 | P59 | integrin-linked kinase | Biochemical Activity | BioGRID | 8538749 |
ILKAP | DKFZp434J2031 | FLJ10181 | MGC4846 | PP2C-DELTA | integrin-linked kinase-associated serine/threonine phosphatase 2C | - | HPRD,BioGRID | 11331582 |
ITGA5 | CD49e | FNRA | VLA5A | integrin, alpha 5 (fibronectin receptor, alpha polypeptide) | Affinity Capture-Western | BioGRID | 8538749 |
ITGB1 | CD29 | FNRB | GPIIA | MDF2 | MSK12 | VLA-BETA | VLAB | integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) | Integrin-beta-1 interacts with ILK. | BIND | 8538749 |
ITGB1 | CD29 | FNRB | GPIIA | MDF2 | MSK12 | VLA-BETA | VLAB | integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) | - | HPRD,BioGRID | 8538749 |9736715 |
ITGB2 | CD18 | LAD | LCAMB | LFA-1 | MAC-1 | MF17 | MFI7 | integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) | - | HPRD | 9736715 |
ITGB3 | CD61 | GP3A | GPIIIa | integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) | - | HPRD,BioGRID | 12372433 |
ITGB3 | CD61 | GP3A | GPIIIa | integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) | Integrin-beta-3 interacts with ILK. | BIND | 12372433 |
LIMS1 | PINCH | PINCH1 | LIM and senescent cell antigen-like domains 1 | PINCH interacts with ILK. | BIND | 15565145 |
LIMS1 | PINCH | PINCH1 | LIM and senescent cell antigen-like domains 1 | - | HPRD,BioGRID | 10022929 |
LIMS2 | FLJ10044 | PINCH-2 | LIM and senescent cell antigen-like domains 2 | - | HPRD,BioGRID | 12167643 |
MARS | FLJ35667 | METRS | MTRNS | methionyl-tRNA synthetase | Affinity Capture-MS | BioGRID | 17353931 |
MMS19 | FLJ34167 | FLJ95146 | MET18 | MGC99604 | MMS19L | hMMS19 | MMS19 nucleotide excision repair homolog (S. cerevisiae) | Affinity Capture-MS | BioGRID | 17353931 |
MYO1D | KIAA0727 | myr4 | myosin ID | Affinity Capture-MS | BioGRID | 17353931 |
NCK2 | GRB4 | NCKbeta | NCK adaptor protein 2 | - | HPRD,BioGRID | 10022929 |
NOC2L | DKFZp564C186 | FLJ35172 | NIR | nucleolar complex associated 2 homolog (S. cerevisiae) | Affinity Capture-MS | BioGRID | 17353931 |
OTUD4 | DKFZp434I0721 | DUBA6 | HIN1 | HSHIN1 | KIAA1046 | OTU domain containing 4 | Affinity Capture-MS | BioGRID | 17353931 |
PARVA | FLJ10793 | FLJ12254 | MXRA2 | parvin, alpha | Two-hybrid | BioGRID | 16189514 |
PARVA | FLJ10793 | FLJ12254 | MXRA2 | parvin, alpha | - | HPRD | 11331308 |15284246 |
PARVA | FLJ10793 | FLJ12254 | MXRA2 | parvin, alpha | - | HPRD | 11331308 |
PARVA | FLJ10793 | FLJ12254 | MXRA2 | parvin, alpha | - | HPRD | 11694518 |
PARVB | CGI-56 | parvin, beta | Affinity Capture-MS | BioGRID | 17353931 |
PARVB | CGI-56 | parvin, beta | - | HPRD | 15467740 |
PARVB | CGI-56 | parvin, beta | - | HPRD | 11402068 |
PARVB | CGI-56 | parvin, beta | An unspecified isoform of affixin interacts with ILK. | BIND | 12372433 |
PDK1 | - | pyruvate dehydrogenase kinase, isozyme 1 | - | HPRD,BioGRID | 11313365 |
PRPSAP1 | PAP39 | phosphoribosyl pyrophosphate synthetase-associated protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
PUF60 | FIR | FLJ31379 | RoBPI | SIAHBP1 | poly-U binding splicing factor 60KDa | Affinity Capture-MS | BioGRID | 17353931 |
PXN | FLJ16691 | paxillin | - | HPRD,BioGRID | 11304546 |11694518 |
RSU1 | FLJ31034 | RSP-1 | Ras suppressor protein 1 | Affinity Capture-MS | BioGRID | 17353931 |
S100A9 | 60B8AG | CAGB | CFAG | CGLB | L1AG | LIAG | MAC387 | MIF | MRP14 | NIF | P14 | S100 calcium binding protein A9 | Affinity Capture-MS | BioGRID | 17353931 |
TMSB4X | FX | PTMB4 | TB4X | TMSB4 | thymosin beta 4, X-linked | ILK interacts with Thymosin Beta-4. | BIND | 15565145 |
VTNR | - | vitronectin receptor | Affinity Capture-Western | BioGRID | 8538749 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PPAR SIGNALING PATHWAY | 69 | 47 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG ENDOMETRIAL CANCER | 52 | 45 | All SZGR 2.0 genes in this pathway |
BIOCARTA PTEN PATHWAY | 18 | 14 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
SA PTEN PATHWAY | 17 | 14 | All SZGR 2.0 genes in this pathway |
PID AVB3 OPN PATHWAY | 31 | 29 | All SZGR 2.0 genes in this pathway |
PID ILK PATHWAY | 45 | 32 | All SZGR 2.0 genes in this pathway |
PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME CELL EXTRACELLULAR MATRIX INTERACTIONS | 14 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME CELL JUNCTION ORGANIZATION | 78 | 43 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
HWANG PROSTATE CANCER MARKERS | 28 | 19 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION DN | 169 | 112 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C5 | 21 | 11 | All SZGR 2.0 genes in this pathway |
VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER HCP WITH H3K27ME3 | 97 | 72 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE UP | 79 | 40 | All SZGR 2.0 genes in this pathway |
HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS DN | 31 | 25 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA CLASSICAL | 162 | 122 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS DN | 213 | 127 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-31 | 190 | 196 | 1A | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
miR-542-3p | 233 | 240 | 1A,m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.