SZGR2

Summary ?

GeneID	3611
Symbol	ILK
Synonyms	HEL-S-28\|ILK-1\|ILK-2\|P59\|p59ILK
Description	integrin linked kinase
Reference	MIM:602366\|HGNC:HGNC:6040\|Ensembl:ENSG00000166333\|HPRD:03842\|Vega:OTTHUMG00000133407
Gene type	protein-coding
Map location	11p15.4
Pascal p-value	0.014
Sherlock p-value	0.298
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2113

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NOTCH3	0.86	0.84
LRIG1	0.84	0.86
BMP7	0.81	0.82
ASAP3	0.80	0.77
SYDE1	0.79	0.80
LAMB2	0.79	0.85
NRARP	0.79	0.75
CTDSP1	0.79	0.79
LTBP3	0.78	0.79
ZFP36L2	0.77	0.79

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NDUFAF2	-0.46	-0.58
VPS29	-0.45	-0.52
PFDN4	-0.45	-0.60
C20orf7	-0.44	-0.52
PSMA6	-0.43	-0.57
GPR22	-0.42	-0.45
MRPL1	-0.41	-0.52
PPP2R3C	-0.41	-0.54
FAM92A1	-0.41	-0.50
TAF9	-0.41	-0.50

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IPI		16936772 \|17353931 \|18339839
GO:0005524	ATP binding	NAS		-
GO:0004674	protein serine/threonine kinase activity	IDA		10871859
GO:0004713	protein tyrosine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0016301	kinase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001658	ureteric bud branching	IEA		-
GO:0007160	cell-matrix adhesion	NAS		-
GO:0006468	protein amino acid phosphorylation	IDA		10871859
GO:0007229	integrin-mediated signaling pathway	IEA		-
GO:0007229	integrin-mediated signaling pathway	NAS		-
GO:0008284	positive regulation of cell proliferation	IEA		-
GO:0045197	establishment or maintenance of epithelial cell apical/basal polarity	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	NAS		-
GO:0005925	focal adhesion	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACP6	ACPL1 \| LPAP \| PACPL1	acid phosphatase 6, lysophosphatidic	Affinity Capture-MS	BioGRID	17353931
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	-	HPRD,BioGRID	9736715
AUP1	-	ancient ubiquitous protein 1	Affinity Capture-MS	BioGRID	17353931
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	ILK1 interacts with caveolin-1.	BIND	15722199
COPB2	beta'-COP	coatomer protein complex, subunit beta 2 (beta prime)	Affinity Capture-MS	BioGRID	17353931
COPG	COPG1 \| FLJ21068	coatomer protein complex, subunit gamma	Affinity Capture-MS	BioGRID	17353931
DDX3X	DBX \| DDX14 \| DDX3 \| HLP2	DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked	Affinity Capture-MS	BioGRID	17353931
DHX36	DDX36 \| G4R1 \| KIAA1488 \| MLEL1 \| RHAU	DEAH (Asp-Glu-Ala-His) box polypeptide 36	Affinity Capture-MS	BioGRID	17353931
ERH	DROER \| FLJ27340	enhancer of rudimentary homolog (Drosophila)	Affinity Capture-MS	BioGRID	17353931
EWSR1	EWS	Ewing sarcoma breakpoint region 1	Affinity Capture-MS	BioGRID	17353931
FANCI	FLJ10719 \| KIAA1794	Fanconi anemia, complementation group I	Affinity Capture-MS	BioGRID	17353931
GEMIN4	DKFZp434B131 \| DKFZp434D174 \| HC56 \| HCAP1 \| HHRF-1 \| p97	gem (nuclear organelle) associated protein 4	Affinity Capture-MS	BioGRID	17353931
GSK3B	-	glycogen synthase kinase 3 beta	-	HPRD	9736715
HEATR1	BAP28 \| FLJ10359 \| MGC72083	HEAT repeat containing 1	Affinity Capture-MS	BioGRID	17353931
HEATR2	FLJ20397 \| FLJ25564 \| FLJ31671 \| FLJ39381	HEAT repeat containing 2	Affinity Capture-MS	BioGRID	17353931
HSPB1	CMT2F \| DKFZp586P1322 \| HMN2B \| HS.76067 \| HSP27 \| HSP28 \| Hsp25 \| SRP27	heat shock 27kDa protein 1	Affinity Capture-MS	BioGRID	17353931
IGF2BP1	CRD-BP \| CRDBP \| IMP-1 \| IMP1 \| VICKZ1 \| ZBP1	insulin-like growth factor 2 mRNA binding protein 1	Affinity Capture-MS	BioGRID	17353931
ILK	DKFZp686F1765 \| P59	integrin-linked kinase	Biochemical Activity	BioGRID	8538749
ILKAP	DKFZp434J2031 \| FLJ10181 \| MGC4846 \| PP2C-DELTA	integrin-linked kinase-associated serine/threonine phosphatase 2C	-	HPRD,BioGRID	11331582
ITGA5	CD49e \| FNRA \| VLA5A	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	Affinity Capture-Western	BioGRID	8538749
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	Integrin-beta-1 interacts with ILK.	BIND	8538749
ITGB1	CD29 \| FNRB \| GPIIA \| MDF2 \| MSK12 \| VLA-BETA \| VLAB	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	-	HPRD,BioGRID	8538749 \|9736715
ITGB2	CD18 \| LAD \| LCAMB \| LFA-1 \| MAC-1 \| MF17 \| MFI7	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	-	HPRD	9736715
ITGB3	CD61 \| GP3A \| GPIIIa	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	-	HPRD,BioGRID	12372433
ITGB3	CD61 \| GP3A \| GPIIIa	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	Integrin-beta-3 interacts with ILK.	BIND	12372433
LIMS1	PINCH \| PINCH1	LIM and senescent cell antigen-like domains 1	PINCH interacts with ILK.	BIND	15565145
LIMS1	PINCH \| PINCH1	LIM and senescent cell antigen-like domains 1	-	HPRD,BioGRID	10022929
LIMS2	FLJ10044 \| PINCH-2	LIM and senescent cell antigen-like domains 2	-	HPRD,BioGRID	12167643
MARS	FLJ35667 \| METRS \| MTRNS	methionyl-tRNA synthetase	Affinity Capture-MS	BioGRID	17353931
MMS19	FLJ34167 \| FLJ95146 \| MET18 \| MGC99604 \| MMS19L \| hMMS19	MMS19 nucleotide excision repair homolog (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
MYO1D	KIAA0727 \| myr4	myosin ID	Affinity Capture-MS	BioGRID	17353931
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	-	HPRD,BioGRID	10022929
NOC2L	DKFZp564C186 \| FLJ35172 \| NIR	nucleolar complex associated 2 homolog (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
OTUD4	DKFZp434I0721 \| DUBA6 \| HIN1 \| HSHIN1 \| KIAA1046	OTU domain containing 4	Affinity Capture-MS	BioGRID	17353931
PARVA	FLJ10793 \| FLJ12254 \| MXRA2	parvin, alpha	Two-hybrid	BioGRID	16189514
PARVA	FLJ10793 \| FLJ12254 \| MXRA2	parvin, alpha	-	HPRD	11331308 \|15284246
PARVA	FLJ10793 \| FLJ12254 \| MXRA2	parvin, alpha	-	HPRD	11331308
PARVA	FLJ10793 \| FLJ12254 \| MXRA2	parvin, alpha	-	HPRD	11694518
PARVB	CGI-56	parvin, beta	Affinity Capture-MS	BioGRID	17353931
PARVB	CGI-56	parvin, beta	-	HPRD	15467740
PARVB	CGI-56	parvin, beta	-	HPRD	11402068
PARVB	CGI-56	parvin, beta	An unspecified isoform of affixin interacts with ILK.	BIND	12372433
PDK1	-	pyruvate dehydrogenase kinase, isozyme 1	-	HPRD,BioGRID	11313365
PRPSAP1	PAP39	phosphoribosyl pyrophosphate synthetase-associated protein 1	Affinity Capture-MS	BioGRID	17353931
PUF60	FIR \| FLJ31379 \| RoBPI \| SIAHBP1	poly-U binding splicing factor 60KDa	Affinity Capture-MS	BioGRID	17353931
PXN	FLJ16691	paxillin	-	HPRD,BioGRID	11304546 \|11694518
RSU1	FLJ31034 \| RSP-1	Ras suppressor protein 1	Affinity Capture-MS	BioGRID	17353931
S100A9	60B8AG \| CAGB \| CFAG \| CGLB \| L1AG \| LIAG \| MAC387 \| MIF \| MRP14 \| NIF \| P14	S100 calcium binding protein A9	Affinity Capture-MS	BioGRID	17353931
TMSB4X	FX \| PTMB4 \| TB4X \| TMSB4	thymosin beta 4, X-linked	ILK interacts with Thymosin Beta-4.	BIND	15565145
VTNR	-	vitronectin receptor	Affinity Capture-Western	BioGRID	8538749

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG PPAR SIGNALING PATHWAY	69	47	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG ENDOMETRIAL CANCER	52	45	All SZGR 2.0 genes in this pathway
BIOCARTA PTEN PATHWAY	18	14	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
SA PTEN PATHWAY	17	14	All SZGR 2.0 genes in this pathway
PID AVB3 OPN PATHWAY	31	29	All SZGR 2.0 genes in this pathway
PID ILK PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID AVB3 INTEGRIN PATHWAY	75	53	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME CELL EXTRACELLULAR MATRIX INTERACTIONS	14	10	All SZGR 2.0 genes in this pathway
REACTOME CELL JUNCTION ORGANIZATION	78	43	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
HWANG PROSTATE CANCER MARKERS	28	19	All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION DN	100	64	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
PENG GLUCOSE DEPRIVATION DN	169	112	All SZGR 2.0 genes in this pathway
VERRECCHIA RESPONSE TO TGFB1 C5	21	11	All SZGR 2.0 genes in this pathway
VERRECCHIA DELAYED RESPONSE TO TGFB1	39	26	All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3	97	72	All SZGR 2.0 genes in this pathway
TOOKER GEMCITABINE RESISTANCE UP	79	40	All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES	389	245	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS DN	31	25	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN	87	66	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN DN	88	68	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN	213	127	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN	315	215	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-31	190	196	1A	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-542-3p	233	240	1A,m8	hsa-miR-542-3p	UGUGACAGAUUGAUAACUGAAA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ILK