Gene Page: INPP5A
Summary ?
GeneID | 3632 |
Symbol | INPP5A |
Synonyms | 5PTASE |
Description | inositol polyphosphate-5-phosphatase A |
Reference | MIM:600106|HGNC:HGNC:6076|Ensembl:ENSG00000068383|HPRD:02521|Vega:OTTHUMG00000019293 |
Gene type | protein-coding |
Map location | 10q26.3 |
Pascal p-value | 0.225 |
Sherlock p-value | 0.456 |
Fetal beta | -1.099 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03487 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
INPP5A | chr10 | 134463942 | C | T | NM_005539 | p.80A>V | missense | Schizophrenia | DNM:Xu_2012 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13795838 | 10 | 134539818 | INPP5A | 3.066E-4 | 0.272 | 0.04 | DMG:Wockner_2014 |
cg22918356 | 10 | 134496823 | INPP5A | 3.212E-4 | 0.35 | 0.04 | DMG:Wockner_2014 |
cg05030346 | 10 | 134596943 | INPP5A | 4.631E-4 | -0.795 | 0.046 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2814453 | chr10 | 134408415 | INPP5A | 3632 | 0.14 | cis | ||
rs7094522 | chr10 | 134482925 | INPP5A | 3632 | 0.1 | cis | ||
rs1538616 | chr14 | 51455471 | INPP5A | 3632 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004437 | inositol or phosphatidylinositol phosphatase activity | IEA | - | |
GO:0004445 | inositol-polyphosphate 5-phosphatase activity | NAS | 8006039 | |
GO:0016787 | hydrolase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007154 | cell communication | NAS | - | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0016020 | membrane | NAS | 8006039 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INOSITOL PHOSPHATE METABOLISM | 54 | 42 | All SZGR 2.0 genes in this pathway |
KEGG PHOSPHATIDYLINOSITOL SIGNALING SYSTEM | 76 | 56 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 2 | 127 | 92 | All SZGR 2.0 genes in this pathway |
FERREIRA EWINGS SARCOMA UNSTABLE VS STABLE DN | 98 | 59 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE DN | 11 | 9 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
MARIADASON REGULATED BY HISTONE ACETYLATION UP | 83 | 49 | All SZGR 2.0 genes in this pathway |
MARIADASON RESPONSE TO CURCUMIN SULINDAC 5 | 23 | 17 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G1 UP | 113 | 70 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17 | 181 | 101 | All SZGR 2.0 genes in this pathway |
NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 175 | 181 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-137 | 1423 | 1430 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-142-3p | 1194 | 1201 | 1A,m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-150 | 955 | 961 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-151 | 690 | 696 | m8 | hsa-miR-151brain | ACUAGACUGAAGCUCCUUGAGG |
miR-181 | 838 | 844 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-23 | 840 | 847 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 840 | 846 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-410 | 563 | 569 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-485-5p | 143 | 149 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC | ||||
miR-491 | 128 | 134 | 1A | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
miR-495 | 904 | 910 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-96 | 921 | 927 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.