SZGR2

Summary ?

GeneID	367
Symbol	AR
Synonyms	AIS\|AR8\|DHTR\|HUMARA\|HYSP1\|KD\|NR3C4\|SBMA\|SMAX1\|TFM
Description	androgen receptor
Reference	MIM:313700\|HGNC:HGNC:644\|Ensembl:ENSG00000169083\|HPRD:02437\|Vega:OTTHUMG00000021740
Gene type	protein-coding
Map location	Xq12
Fetal beta	-0.408

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypal	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1813

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IPI	Neurotransmitter (GO term level: 4)	11875111
GO:0004872	receptor activity	IEA		-
GO:0004882	androgen receptor activity	IEA		-
GO:0004882	androgen receptor activity	NAS		10075738
GO:0004882	androgen receptor activity	TAS		15572661
GO:0003700	transcription factor activity	IDA		15572661
GO:0003700	transcription factor activity	IEA		-
GO:0005496	steroid binding	IEA		-
GO:0005497	androgen binding	NAS		10075738
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
GO:0046983	protein dimerization activity	NAS		10075738
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001701	in utero embryonic development	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0016049	cell growth	NAS		15572661
GO:0007267	cell-cell signaling	TAS		10835690
GO:0007165	signal transduction	TAS		10835690
GO:0008283	cell proliferation	NAS		10075738
GO:0008584	male gonad development	IEA		-
GO:0007548	sex differentiation	NAS		10075738
GO:0006810	transport	TAS		10835690
GO:0030850	prostate gland development	NAS		10075738
GO:0019102	male somatic sex determination	IEA		-
GO:0030521	androgen receptor signaling pathway	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		15572661
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IDA		15572661

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AES	AES-1 \| AES-2 \| ESP1 \| GRG \| GRG5 \| TLE5	amino-terminal enhancer of split	-	HPRD,BioGRID	11416139
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Akt phosphorylates AR.	BIND	11404460 \|12621049
AKT1	AKT \| MGC99656 \| PKB \| PKB-ALPHA \| PRKBA \| RAC \| RAC-ALPHA	v-akt murine thymoma viral oncogene homolog 1	Affinity Capture-Western Reconstituted Complex	BioGRID	11404460
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Biochemical Activity Co-crystal Structure Protein-peptide Two-hybrid	BioGRID	11504717 \|12612084 \|12682292 \|14593076 \|14729952 \|14966121 \|14966297 \|15062556 \|15256534 \|15525515
BAG1	RAP46	BCL2-associated athanogene	-	HPRD,BioGRID	11278763
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD,BioGRID	11016951 \|11085509
CALM1	CALML2 \| CAMI \| DD132 \| PHKD	calmodulin 1 (phosphorylase kinase, delta)	Affinity Capture-Western Co-localization Reconstituted Complex	BioGRID	14695896
CALR	CRT \| FLJ26680 \| RO \| SSA \| cC1qR	calreticulin	-	HPRD,BioGRID	8107809
CASP1	ICE \| IL1BC \| P45	caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)	Androgen Receptor interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human androgen receptor and caspase 1 from an unspecified species.	BIND	9535906
CASP3	CPP32 \| CPP32B \| SCA-1	caspase 3, apoptosis-related cysteine peptidase	Androgen Receptor interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human androgen receptor and caspase 3 from an unspecified species.	BIND	9535906
CASP7	CMH-1 \| ICE-LAP3 \| MCH3	caspase 7, apoptosis-related cysteine peptidase	Androgen Receptor interacts with caspase 7.	BIND	9535906
CASP8	ALPS2B \| CAP4 \| FLICE \| FLJ17672 \| MACH \| MCH5 \| MGC78473	caspase 8, apoptosis-related cysteine peptidase	Androgen Receptor interacts with caspase 8.	BIND	9535906
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	-	HPRD,BioGRID	11278309
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	Caveolin-1 interacts with AR.	BIND	11278309
CCND1	BCL1 \| D11S287E \| PRAD1 \| U21B31	cyclin D1	-	HPRD,BioGRID	10344732
CCNE1	CCNE	cyclin E1	-	HPRD,BioGRID	10953010
CCNH	CAK \| p34 \| p37	cyclin H	Reconstituted Complex	BioGRID	10734072
CDC25B	-	cell division cycle 25 homolog B (S. pombe)	-	HPRD,BioGRID	12569365
CDC37	P50CDC37	cell division cycle 37 homolog (S. cerevisiae)	-	HPRD,BioGRID	11085988
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	Affinity Capture-Western Reconstituted Complex	BioGRID	10734072
CDK9	C-2k \| CDC2L4 \| CTK1 \| PITALRE \| TAK	cyclin-dependent kinase 9	-	HPRD,BioGRID	11266437
CEBPA	C/EBP-alpha \| CEBP	CCAAT/enhancer binding protein (C/EBP), alpha	Reconstituted Complex	BioGRID	9817600
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	Reconstituted Complex	BioGRID	9817600
COX5B	COXVB	cytochrome c oxidase subunit Vb	-	HPRD,BioGRID	11719263
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	9482849
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD,BioGRID	11916967
DAP3	DAP-3 \| DKFZp686G12159 \| MGC126058 \| MGC126059 \| MRP-S29 \| MRPS29 \| bMRP-10	death associated protein 3	-	HPRD,BioGRID	10903152
DAXX	BING2 \| DAP6 \| EAP1 \| MGC126245 \| MGC126246	death-domain associated protein	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	15572661
DCC	CRC18 \| CRCR1	deleted in colorectal carcinoma	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	12864730
EFCAB6	DJBP \| FLJ23588 \| HSCBCIP1 \| KIAA1672 \| dJ185D5.1	EF-hand calcium binding domain 6	-	HPRD,BioGRID	12612053
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Affinity Capture-Western Co-localization	BioGRID	15288768 \|15305378
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	-	HPRD,BioGRID	12389206
ETV5	ERM	ets variant 5	Reconstituted Complex	BioGRID	8798622
ETV5	ERM	ets variant 5	-	HPRD	11509567
FGF8	AIGF \| HBGF-8 \| MGC149376	fibroblast growth factor 8 (androgen-induced)	AR interacts with FGF8 promoter.	BIND	12140757
FHL2	AAG11 \| DRAL \| SLIM3	four and a half LIM domains 2	-	HPRD,BioGRID	10654935
FLNA	ABP-280 \| ABPX \| DKFZp434P031 \| FLN \| FLN1 \| FMD \| MNS \| NHBP \| OPD \| OPD1 \| OPD2	filamin A, alpha (actin binding protein 280)	-	HPRD,BioGRID	12682292
FOXA1	HNF3A \| MGC33105 \| TCF3A	forkhead box A1	-	HPRD,BioGRID	12750453
FOXO1	FKH1 \| FKHR \| FOXO1A	forkhead box O1	-	HPRD,BioGRID	12482965
GAPDH	G3PD \| GAPD \| MGC88685	glyceraldehyde-3-phosphate dehydrogenase	-	HPRD,BioGRID	8872471
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	-	HPRD,BioGRID	12958311
GRIP1	GRIP	glutamate receptor interacting protein 1	Two-hybrid	BioGRID	10607837
GSK3A	DKFZp686D0638	glycogen synthase kinase 3 alpha	Affinity Capture-Western	BioGRID	15361837
GSK3B	-	glycogen synthase kinase 3 beta	Affinity Capture-Western Reconstituted Complex	BioGRID	15178691
GSN	DKFZp313L0718	gelsolin (amyloidosis, Finnish type)	-	HPRD,BioGRID	12941811
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	-	HPRD,BioGRID	9238003
GTF2F2	BTF4 \| RAP30 \| TF2F2 \| TFIIF	general transcription factor IIF, polypeptide 2, 30kDa	-	HPRD,BioGRID	9238003
GTF2H1	BTF2 \| TFB1 \| TFIIH	general transcription factor IIH, polypeptide 1, 62kDa	-	HPRD,BioGRID	10734072 \|11266437
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD,BioGRID	11994312
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	Reconstituted Complex	BioGRID	12943985
HDAC4	HA6116 \| HD4 \| HDAC-A \| HDACA \| KIAA0288	histone deacetylase 4	Reconstituted Complex	BioGRID	12943985
HMGB1	DKFZp686A04236 \| HMG1 \| HMG3 \| SBP-1	high-mobility group box 1	-	HPRD,BioGRID	9671457
HMGB2	HMG2	high-mobility group box 2	Reconstituted Complex	BioGRID	9671457
HNF4A	FLJ39654 \| HNF4 \| HNF4a7 \| HNF4a8 \| HNF4a9 \| MODY \| MODY1 \| NR2A1 \| NR2A21 \| TCF \| TCF14	hepatocyte nuclear factor 4, alpha	Co-localization	BioGRID	12944908
HSP90AA1	FLJ31884 \| HSP86 \| HSP89A \| HSP90A \| HSP90N \| HSPC1 \| HSPCA \| HSPCAL1 \| HSPCAL4 \| HSPN \| Hsp89 \| Hsp90 \| LAP2	heat shock protein 90kDa alpha (cytosolic), class A member 1	-	HPRD,BioGRID	1525041
HSPA1A	FLJ54303 \| FLJ54370 \| FLJ54392 \| FLJ54408 \| FLJ75127 \| HSP70-1 \| HSP70-1A \| HSP70I \| HSP72 \| HSPA1 \| HSPA1B	heat shock 70kDa protein 1A	Affinity Capture-Western	BioGRID	1540595
IDE	FLJ35968 \| INSULYSIN	insulin-degrading enzyme	-	HPRD	8051160
IL6ST	CD130 \| CDw130 \| GP130 \| GP130-RAPS \| IL6R-beta	interleukin 6 signal transducer (gp130, oncostatin M receptor)	Affinity Capture-Western	BioGRID	15129430
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	8798722 \|9211894
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	Biochemical Activity Two-hybrid	BioGRID	11994312
KAT5	ESA1 \| HTATIP \| HTATIP1 \| PLIP \| TIP \| TIP60 \| cPLA2	K(lysine) acetyltransferase 5	-	HPRD	10364196
KLK2	KLK2A2 \| MGC12201 \| hK2	kallikrein-related peptidase 2	AR interacts with p-KLK-2.	BIND	15542435
KLK3	APS \| KLK2A1 \| PSA \| hK3	kallikrein-related peptidase 3	AR interacts with p-PSA.	BIND	15542435
MAGEA11	MAGE-11 \| MAGE11 \| MAGEA-11 \| MGC10511	melanoma antigen family A, 11	Affinity Capture-Western Co-localization Reconstituted Complex Two-hybrid	BioGRID	15684378
MAPK1	ERK \| ERK2 \| ERT1 \| MAPK2 \| P42MAPK \| PRKM1 \| PRKM2 \| p38 \| p40 \| p41 \| p41mapk	mitogen-activated protein kinase 1	Reconstituted Complex	BioGRID	10318905
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	-	HPRD	12145204
MED1	CRSP1 \| CRSP200 \| DRIP205 \| DRIP230 \| MGC71488 \| PBP \| PPARBP \| PPARGBP \| RB18A \| TRAP220 \| TRIP2	mediator complex subunit 1	-	HPRD,BioGRID	12218053
MED14	CRSP150 \| CRSP2 \| CSRP \| CXorf4 \| DRIP150 \| EXLM1 \| MGC104513 \| RGR1 \| TRAP170	mediator complex subunit 14	-	HPRD,BioGRID	12218053
MYBBP1A	FLJ37886 \| P160 \| PAP2	MYB binding protein (P160) 1a	-	HPRD	11779876
MYST2	HBO1 \| HBOA \| KAT7	MYST histone acetyltransferase 2	-	HPRD,BioGRID	10930412
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	SRC-1a interacts with AR.	BIND	10454563
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD,BioGRID	10567563
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	SRC-1e interacts with AR.	BIND	10454563
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	12612084 \|12810069 \|14593076 \|14966121
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	GRIP1 interacts with AR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human AR.	BIND	10454563
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	-	HPRD	9717843
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	-	HPRD	9717843 \|12588987
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	-	HPRD,BioGRID	10965917
NCOA4	ARA70 \| DKFZp762E1112 \| ELE1 \| PTC3 \| RFG	nuclear receptor coactivator 4	-	HPRD	8643607 \|9892017 \|10517667 \|11818501
NCOA4	ARA70 \| DKFZp762E1112 \| ELE1 \| PTC3 \| RFG	nuclear receptor coactivator 4	Far Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	8643607 \|9636157 \|9892017 \|10318905 \|10517667 \|11404460 \|11779876 \|11818501 \|12612084 \|14966297
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Affinity Capture-Western Two-hybrid	BioGRID	14645241
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	-	HPRD,BioGRID	12089345
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	Affinity Capture-Western Co-localization Reconstituted Complex Two-hybrid	BioGRID	11923464 \|12441355 \|14593076
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD	8798655
NISCH	FLJ14425 \| FLJ40413 \| FLJ90519 \| I-1 \| IRAS \| KIAA0975	nischarin	-	HPRD,BioGRID	15028622
NONO	NMT55 \| NRB54 \| P54 \| P54NRB	non-POU domain containing, octamer-binding	-	HPRD,BioGRID	12810069
NR0B1	AHC \| AHCH \| AHX \| DAX-1 \| DAX1 \| DSS \| GTD \| HHG \| NROB1	nuclear receptor subfamily 0, group B, member 1	-	HPRD,BioGRID	11875111
NR0B2	FLJ17090 \| SHP \| SHP1	nuclear receptor subfamily 0, group B, member 2	-	HPRD,BioGRID	11735420
NR2C1	TR2	nuclear receptor subfamily 2, group C, member 1	-	HPRD,BioGRID	12949936
NR2C2	TAK1 \| TR2R1 \| TR4 \| hTAK1	nuclear receptor subfamily 2, group C, member 2	-	HPRD,BioGRID	10611280
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD,BioGRID	9162033
NSD1	ARA267 \| DKFZp666C163 \| FLJ10684 \| FLJ22263 \| FLJ44628 \| KMT3B \| SOTOS \| STO	nuclear receptor binding SET domain protein 1	-	HPRD	11509567
NSD1	ARA267 \| DKFZp666C163 \| FLJ10684 \| FLJ22263 \| FLJ44628 \| KMT3B \| SOTOS \| STO	nuclear receptor binding SET domain protein 1	-	HPRD,BioGRID	11266437\|11509567
PA2G4	EBP1 \| HG4-1 \| p38-2G4	proliferation-associated 2G4, 38kDa	Affinity Capture-Western Reconstituted Complex	BioGRID	12165860
PA2G4	EBP1 \| HG4-1 \| p38-2G4	proliferation-associated 2G4, 38kDa	-	HPRD	9565586
PAK6	PAK5	p21 protein (Cdc42/Rac)-activated kinase 6	-	HPRD,BioGRID	11278661
PATZ1	MAZR \| PATZ \| RIAZ \| ZBTB19 \| ZNF278 \| ZSG \| dJ400N23	POZ (BTB) and AT hook containing zinc finger 1	Affinity Capture-Western	BioGRID	11719514
PELP1	HMX3 \| MNAR \| P160	proline, glutamate and leucine rich protein 1	-	HPRD,BioGRID	12415108
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	-	HPRD	11877418
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	Two-hybrid	BioGRID	11117529
PIAS2	MGC102682 \| MIZ1 \| PIASX \| PIASX-ALPHA \| PIASX-BETA \| SIZ2 \| ZMIZ4 \| miz	protein inhibitor of activated STAT, 2	Reconstituted Complex Two-hybrid	BioGRID	9920921 \|11117529
PIAS3	FLJ14651 \| ZMIZ5	protein inhibitor of activated STAT, 3	Two-hybrid	BioGRID	11117529
PIAS4	FLJ12419 \| MGC35296 \| PIASY \| Piasg \| ZMIZ6	protein inhibitor of activated STAT, 4	-	HPRD,BioGRID	11439351
PNRC1	B4-2 \| PNAS-145 \| PROL2 \| PRR2 \| RP11-63L7.5	proline-rich nuclear receptor coactivator 1	-	HPRD	10428808
PNRC2	FLJ20312 \| MGC99541	proline-rich nuclear receptor coactivator 2	-	HPRD	10894149
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	-	HPRD,BioGRID	10480874
POU2F2	OCT2 \| OTF2 \| Oct-2	POU class 2 homeobox 2	Reconstituted Complex	BioGRID	10480874
PRKDC	DNA-PKcs \| DNAPK \| DNPK1 \| HYRC \| HYRC1 \| XRCC7 \| p350	protein kinase, DNA-activated, catalytic polypeptide	Affinity Capture-MS	BioGRID	15640154
PRMT1	ANM1 \| HCP1 \| HRMT1L2 \| IR1B4	protein arginine methyltransferase 1	Reconstituted Complex	BioGRID	11050077
PRPF6	ANT-1 \| C20orf14 \| TOM \| U5-102K \| hPrp6	PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)	-	HPRD,BioGRID	12039962
PSPC1	DKFZp566B1447 \| FLJ10955 \| PSP1	paraspeckle component 1	Affinity Capture-MS	BioGRID	12810069
PTEN	10q23del \| BZS \| MGC11227 \| MHAM \| MMAC1 \| PTEN1 \| TEP1	phosphatase and tensin homolog	Affinity Capture-Western Reconstituted Complex	BioGRID	15205473
RAC3	-	ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)	-	HPRD	11747336
RAD9A	RAD9	RAD9 homolog A (S. pombe)	Two-hybrid	BioGRID	14966297
RAF1	CRAF \| NS5 \| Raf-1 \| c-Raf	v-raf-1 murine leukemia viral oncogene homolog 1	-	HPRD,BioGRID	8349631
RAN	ARA24 \| Gsp1 \| TC4	RAN, member RAS oncogene family	-	HPRD,BioGRID	10400640
RANBP9	RANBPM	RAN binding protein 9	-	HPRD,BioGRID	12361945
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Rb interacts with AR.	BIND	9675141
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	9675141
RCHY1	ARNIP \| CHIMP \| DKFZp586C1620 \| PIRH2 \| PRO1996 \| RNF199 \| ZNF363 \| hARNIP	ring finger and CHY zinc finger domain containing 1	-	HPRD,BioGRID	12200228
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD	8798655
RNF14	ARA54 \| FLJ26004 \| HFB30 \| HRIHFB2038 \| TRIAD2	ring finger protein 14	-	HPRD,BioGRID	10085091
RNF4	RES4-26 \| SNURF	ring finger protein 4	-	HPRD,BioGRID	9710597 \|10617653 \|11719514
SART3	DSAP1 \| KIAA0156 \| MGC138188 \| P100 \| RP11-13G14 \| TIP110 \| p110 \| p110(nrb)	squamous cell carcinoma antigen recognized by T cells 3	-	HPRD,BioGRID	15031286
SELENBP1	FLJ13813 \| LPSB \| SP56 \| hSBP \| hSP56	selenium binding protein 1	Affinity Capture-Western	BioGRID	1540595
SLC25A4	AAC1 \| ANT \| ANT1 \| PEO2 \| PEO3 \| T1	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	-	HPRD	12039962
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	-	HPRD,BioGRID	11280774
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	-	HPRD,BioGRID	12226080
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Affinity Capture-Western	BioGRID	14966121
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Affinity Capture-Western	BioGRID	14966121
SP1	-	Sp1 transcription factor	Affinity Capture-Western	BioGRID	15661808
SPDEF	PDEF \| RP11-375E1__A.3 \| bA375E1.3	SAM pointed domain containing ets transcription factor	-	HPRD,BioGRID	10625666
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Affinity Capture-Western Two-hybrid	BioGRID	11032808 \|15027889 \|15466214
SRY	TDF \| TDY	sex determining region Y	-	HPRD,BioGRID	11585838
STAT3	APRF \| FLJ20882 \| HIES \| MGC16063	signal transducer and activator of transcription 3 (acute-phase response factor)	-	HPRD,BioGRID	11751884
SVIL	DKFZp686A17191	supervillin	-	HPRD,BioGRID	11792840
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Reconstituted Complex	BioGRID	9238003
TCF4	E2-2 \| ITF2 \| MGC149723 \| MGC149724 \| PTHS \| SEF2 \| SEF2-1 \| SEF2-1A \| SEF2-1B \| bHLHb19	transcription factor 4	-	HPRD,BioGRID	12799378
TDG	-	thymine-DNA glycosylase	Reconstituted Complex	BioGRID	12874288
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	-	HPRD	11155740
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	The carboxy terminus of ARA55 interacts with the carboxy terminus AR to enhance transcriptional activity.	BIND	10075738
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	11779876 \|11856738
TMF1	ARA160	TATA element modulatory factor 1	Far Western Reconstituted Complex Two-hybrid	BioGRID	10428808
TMF1	ARA160	TATA element modulatory factor 1	-	HPRD	12165860
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Biochemical Activity Phenotypic Suppression	BioGRID	11504717
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	-	HPRD,BioGRID	9115274
TSG101	TSG10 \| VPS23	tumor susceptibility gene 101	-	HPRD,BioGRID	10508170
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	Affinity Capture-Western Phenotypic Enhancement Two-hybrid	BioGRID	10383460
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	-	HPRD	8798622
UXT	ART-27	ubiquitously-expressed transcript	-	HPRD,BioGRID	11854421
XRCC5	FLJ39089 \| KARP-1 \| KARP1 \| KU80 \| KUB2 \| Ku86 \| NFIV	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	Reconstituted Complex	BioGRID	15640154
XRCC6	CTC75 \| CTCBF \| G22P1 \| KU70 \| ML8 \| TLAA	X-ray repair complementing defective repair in Chinese hamster cells 6	Affinity Capture-Western	BioGRID	15640154
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	Reconstituted Complex	BioGRID	11266503
ZMIZ1	FLJ13541 \| KIAA1224 \| MIZ \| RAI17 \| Zimp10 \| hZIMP10	zinc finger, MIZ-type containing 1	-	HPRD,BioGRID	14609956

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG OOCYTE MEIOSIS	114	79	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
ST ADRENERGIC	36	29	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID AR TF PATHWAY	53	38	All SZGR 2.0 genes in this pathway
PID AR NONGENOMIC PATHWAY	31	27	All SZGR 2.0 genes in this pathway
PID BETA CATENIN NUC PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY	44	29	All SZGR 2.0 genes in this pathway
PID HES HEY PATHWAY	48	39	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY	49	36	All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN	391	222	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS TOP50 UP	38	27	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER CLASSES UP	72	38	All SZGR 2.0 genes in this pathway
DOANE BREAST CANCER ESR1 UP	112	72	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN	120	73	All SZGR 2.0 genes in this pathway
OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP DN	35	20	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR	43	35	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 3	48	31	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS LUMINAL	326	213	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER CLUSTER 7	20	11	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN	114	58	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 LASER UP	34	25	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
KHETCHOUMIAN TRIM24 TARGETS DN	8	7	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN	65	45	All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP	244	165	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
ZHU CMV 8 HR DN	53	40	All SZGR 2.0 genes in this pathway
ZHU CMV ALL DN	128	93	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A UP	81	52	All SZGR 2.0 genes in this pathway
HOWLIN CITED1 TARGETS 1 DN	37	22	All SZGR 2.0 genes in this pathway
LEIN MEDULLA MARKERS	81	48	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P6	91	44	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER MARKERS	19	16	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN	85	58	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER ERBB2 UP	147	83	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN	108	68	All SZGR 2.0 genes in this pathway
MATZUK MALE REPRODUCTION SERTOLI	28	23	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL UP	185	112	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 UP	176	110	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS PROLIFERATION DN	179	97	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL DN	113	76	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
LI PROSTATE CANCER EPIGENETIC	30	22	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES DN	210	141	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP	134	85	All SZGR 2.0 genes in this pathway
SUBTIL PROGESTIN TARGETS	36	25	All SZGR 2.0 genes in this pathway
CHANGOLKAR H2AFY TARGETS DN	40	26	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN	214	124	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	71	77	1A	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-493-5p	113	119	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: AR