Summary ?
GeneID3766
SymbolKCNJ10
SynonymsBIRK-10|KCNJ13-PEN|KIR1.2|KIR4.1|SESAME
Descriptionpotassium voltage-gated channel subfamily J member 10
ReferenceMIM:602208|HGNC:HGNC:6256|Ensembl:ENSG00000177807|HPRD:03732|Vega:OTTHUMG00000024073
Gene typeprotein-coding
Map location1q23.2
Sherlock p-value0.314
Fetal beta-2.301
SupportEXCITABILITY

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IGenome scan meta-analysisPsr: 0.0235 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00814 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
FN10.840.84
LAMC10.800.78
ITGA10.790.79
LAMA40.770.76
ETS10.760.73
AFAP1L10.760.72
CD930.740.77
NID10.740.78
VCL0.740.71
FAM124B0.730.64
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
TREX1-0.42-0.51
AC018755.7-0.42-0.50
ASPDH-0.40-0.46
JOSD2-0.40-0.42
MT3-0.40-0.46
ARL6IP4-0.39-0.46
CHCHD10-0.39-0.47
KB-1839H6.1-0.39-0.47
TMEM219-0.38-0.46
SFTPC-0.38-0.43

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005515protein bindingIEA-
GO:0005524ATP bindingIEA-
GO:0005244voltage-gated ion channel activityIEA-
GO:0005267potassium channel activityIEA-
GO:0015272ATP-activated inward rectifier potassium channel activityTAS8995301 
GO:0030955potassium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
GO:0006813potassium ion transportTAS8995301 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS8995301 

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES 186155All SZGR 2.0 genes in this pathway
REACTOME NEURONAL SYSTEM 279221All SZGR 2.0 genes in this pathway
REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL 137110All SZGR 2.0 genes in this pathway
REACTOME INHIBITION OF VOLTAGE GATED CA2 CHANNELS VIA GBETA GAMMA SUBUNITS 2517All SZGR 2.0 genes in this pathway
REACTOME GABA B RECEPTOR ACTIVATION 3826All SZGR 2.0 genes in this pathway
REACTOME GABA RECEPTOR ACTIVATION 5240All SZGR 2.0 genes in this pathway
REACTOME POTASSIUM CHANNELS 9868All SZGR 2.0 genes in this pathway
REACTOME INWARDLY RECTIFYING K CHANNELS 3120All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA UP 205140All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357212All SZGR 2.0 genes in this pathway
COATES MACROPHAGE M1 VS M2 UP 8152All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540340All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491319All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725838All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-17-5p/20/93.mr/106/519.d222122281A,m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU